Preparation method of MC3R gene edited porcine fibroblast line
A porcine fibrogenesis and gene editing technology, applied in the field of gene editing, can solve the problems of unclear physiological function and mechanism of action of MC3R
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] 1. The construction of a MC3R gene knockout vector, comprising:
[0039] 1.1 Target design
[0040] Using the BAC sequence (CH242-163M14) of the pig chromosome 17 clone of the MC3R gene as a reference, primers were designed to amplify the MC3R gene and part of its regulatory region in large white pig cells: Genomic DNA was extracted strictly according to the instructions of QIAGEN 69506 DNeasy Blood&TissueKit (250), The following primers were designed for identification amplification: MC-F: TGCTATCGACCGGACGCCAATC; MC-R: ACTGCACTGCTCAACCTATTAC. The reaction system is: 10×LA Buffer 2μL, 2.5mM dNTPs 1.6μL, CX-F1 1μL, CX-R2 1μL, LA DNA Polymerase 0.2μL, Genomic DNA 10μL, ddH 2 O 4.2 μL. Reaction program: 94°C for 2min, 98°C for 10s, 69°C for 200s, cycle 30 times, 72°C for 10min, and store at 4°C. After the PCR reaction was completed, the product was mixed with 4 μL 6x Loding Buffer, and electrophoresed on a 1% agarose gel. After amplification, agarose gel electrophoresi...
Embodiment 2
[0079] The preparation method of the improved trypsin digestion solution is: accurately weigh 0.5g of EDTA, 1.0g of dextrose, 9.6g of PBS powder, 3.0g of Tris base, 0.3g of 2-ethyl-3-hydroxy-4-pyrone, Dissolve in 900mL of ultrapure water, adjust the pH to 7.6, then add 1g of trypsin, dissolve and dilute to 1L, filter through a 0.2μm membrane, and store at -20°C.
[0080] 2.4.2 Electric shock transfection: when the confluence of the cells is 75%, take out the 12-well plate, suck up the medium with a pipette gun, add 2ml PBS to each well and rinse twice; add 500 μL of modified trypsin digestion solution, Digest in a constant temperature incubator at 37°C for about 30 seconds; add 2ml of DMEM medium with 10% FBS to stop the digestion, gently pipette several times with a pipette gun to ensure that all the cells are digested, and the rest is exactly the same as in Example 1.
Embodiment 3
[0082] The preparation method of the improved trypsin digestion solution is as follows: accurately weigh 0.5g of EDTA, 1.0g of dextrose, 9.6g of PBS powder, 3.0g of Tris base, 0.15g of 2-ethyl-3-hydroxy-4-pyrone, Dissolve in 900mL of ultrapure water, adjust the pH to 7.6, then add 1g of trypsin, dissolve and dilute to 1L, filter through a 0.2μm membrane, and store at -20°C. The rest are completely consistent with Example 2.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com