Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Helicobacter pylori mutant strain capable of stimulating immune response and construction method and application thereof

A technology of Helicobacter pylori, immune response, applied in the field of bioengineering

Pending Publication Date: 2020-10-30
NANCHANG UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the use of Helicobacter pylori outer membrane vesicles in vaccine development requires that the outer membrane LPS of Helicobacter pylori can efficiently stimulate the host to produce an immune response, but this problem still needs to be resolved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Helicobacter pylori mutant strain capable of stimulating immune response and construction method and application thereof
  • Helicobacter pylori mutant strain capable of stimulating immune response and construction method and application thereof
  • Helicobacter pylori mutant strain capable of stimulating immune response and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] 1. ΔfutB primer design and PCR amplification

[0058] According to the reported sequence of Helicobacter pylori 26695 strain (GCA_000008525.1 with reference to the GenBank sequence number), two pairs of fusion PCR primers were designed to amplify the upstream homology arm and the downstream homology arm of the futB gene respectively, and the amplified fragment sizes were 670bp and 600bp, the above primers were synthesized by Beijing Huada Gene Company, and the primer sequences are as follows:

[0059] futB left-up: 5'GCTGCAGCTTTAGCCATTGCGGGTTTG 3'

[0060] futB left-down: 5'CGGAATTCCGggtcatgaccccattattgaatg'

[0061] futB right-up: 5'CGGGATCCCG gatgtggcgtagtctcagg 3'

[0062] futB right-down: 5'CCATCGATGGgtgccaccggcatcaatac 3'

[0063] 2. Amplification of the upper and lower homology arms of the Helicobacter pylori futB gene

[0064] Inoculate the freeze-dried Helicobacter pylori 26695 strain into the Brucella broth plate for overnight culture in a microaerophilic e...

Embodiment 2

[0073] 1. ΔlpxE primer design and PCR amplification

[0074] According to the reported Helicobacter pylori 26695 strain sequence (GCA_000008525.1 with reference to the GenBank sequence number), two pairs of fusion PCR primers were designed to amplify the upstream homology arm and the downstream homology arm of the lpxE gene respectively, and the amplified fragment sizes were 600bp and 500bp, the above primers were synthesized by Beijing Huada Gene Company, and the primer sequences are as follows:

[0075] lpxE left-up: 5'GCTGCAGC GGCGTGATGAAATCCTACAAC 3'

[0076] lpxE left-down: 5’CGGAATTCCG cgctaatgaaatagaaagcaacgg 3’

[0077] lpxE right-up: 5'CGGGATCCCG taacgcctatgacaacacc 3'

[0078] lpxE right-down: 5'CCATCGATGG cctaccgcatctctttggatg 3'.

[0079] 2. Amplification of the upper and lower homology arms of the Helicobacter pylori lpxE gene

[0080] Inoculate the freeze-dried Helicobacter pylori 26695 strain into the Brucella broth plate for overnight culture in a microaero...

Embodiment 3

[0089] 1. ΔlpxF primer design and PCR amplification

[0090] According to the reported Helicobacter pylori 26695 strain sequence (GCA_000008525.1 with reference to the GenBank sequence number), two pairs of fusion PCR primers were designed to amplify the upstream homology arm and the downstream homology arm of the lpxE gene respectively, and the amplified fragment sizes were 700bp and 600bp, the above primers were synthesized by Beijing Huada Gene Company, and the primer sequences are as follows:

[0091] lpxF left-up: 5'GCTGCAGC ttaaagcatgagatgaccgctg 3'

[0092] lpxF left-down: 5’CGGAATTCCGgtttgaagcgagaactcataaccc’

[0093] lpxF right-up: 5'CGGGATCCCG gtctaatttagcgatcgcttcac 3'

[0094] lpxF right-down: 5'CCATCGATGG cgcatttttctaggatcgtgtc 3'.

[0095] 2. Amplification of the upper and lower homology arms of the Helicobacter pylori lpxF gene

[0096] Inoculate the freeze-dried Helicobacter pylori 26695 strain into the Brucella broth plate for overnight culture in a microa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a helicobacter pylori mutant strain capable of stimulating immune response and a construction method and application of the helicobacter pylori mutant strain, and belongs to thetechnical field of bioengineering. The mutant strain provided by the invention does not contain a gene futB for encoding glycosyltransferase in an O antigen synthesis process, meanwhile, a lipid A structure is modified, related synthesis genes lpxE and lpxF are knocked out, and the preservation number of the strain is CCTCC NO: M 2020028. The helicobacter pylori outer membrane vesicle vaccine canefficiently stimulate a host to generate immune response and secrete the outer membrane vesicle, so that the helicobacter pylori outer membrane vesicle has the characteristic of high vaccine efficacy. Meanwhile, the method can effectively enable helicobacter pylori lipid A to be recognized by TLR4 again, enables lipid A to have adjuvant activity, and can better serve antigen presentation. The method can be used for constructing novel helicobacter pylori antigen presenting plasmids, antigen protein is presented to periplasmids of bacteria or exposed to the surface of an outer membrane of the bacteria through different strategies, and therefore the efficiency of immunoreaction generated by host recognition of a target antigen is improved.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a Helicobacter pylori mutant strain stimulating immune response, its construction method and application. Background technique [0002] Helicobacter pylori (H. pylori, referred to as Hp) is a microaerophilic Gram-negative bacteria that can persist in the human stomach and duodenum for life. It can cause mild chronic inflammation of the gastric mucosa, Severe cases even lead to gastric and duodenal ulcers and gastric cancer. Helicobacter pylori infection is the most common bacterial infectious disease in humans, and more than half of the world's population is infected with Helicobacter pylori. This infection is associated with many gastric diseases such as chronic atrophic gastritis, peptic ulcer, gastric or gastric cancer and mucosa-associated lymphoid tissue (MALT) lymphoma. [0003] At this stage, the most commonly used method to prevent and treat Helicobac...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/54C12N15/55C12N15/70C12N15/66C12N15/90A61K39/02A61P31/04C12R1/01
CPCC12N9/1048C12N9/16C12N15/70C12N15/66C12N15/902A61K39/0208A61P31/04
Inventor 刘琼黄孝天李标先曾令兵
Owner NANCHANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com