Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction method of universal gene detection library for hereditary familial hypercholesterolemia and kit of construction method

A technology for hypercholesterolemia and gene detection, applied in the field of gene detection, can solve the problems of clinical application limitations, library incompatibility, etc.

Active Publication Date: 2020-10-23
ANNGEEN BIOTECHNOLOGY CO LTD
View PDF9 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the NGS sequencing platforms widely used in clinical practice are mainly Ion Torrent and Illumina. However, due to the different principles of sequencing technology, different platforms use different technical procedures when constructing libraries, which makes the libraries not universal. Platforms generate sequencing data and vice versa
This has greatly limited clinical applications, so it is necessary to find a universal gene detection library for hereditary familial hypercholesterolemia, which is suitable for different sequencing platforms and adapts to different clinical needs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of universal gene detection library for hereditary familial hypercholesterolemia and kit of construction method
  • Construction method of universal gene detection library for hereditary familial hypercholesterolemia and kit of construction method
  • Construction method of universal gene detection library for hereditary familial hypercholesterolemia and kit of construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1 Design and preparation of universal high-throughput sequencing adapters

[0059] Based on the applicant's previous patent application CN202010407833.5, a universal sequencing linker sequence that can be used for LDLR, APOB, PCSK9 and LDLRAP1 genes, and is also suitable for Ion Torrent and Illumina multi-sequencing platforms is designed and prepared. The specific method is as follows:

[0060] according to figure 1 The composition of the linker assembly shown is to design 10 sets of universal high-throughput sequencing linker AN1 / PN1-AN10 / PN10 for the entire coding region and variable splicing region of LDLR, APOB, PCSK9 and LDLRAP1 genes, which have:

[0061] First synthesize the following single strand

[0062] sequence a:

[0063] 5'- XXXXXXTAGCTGAGTCGGAGACACGCAGGATCGGAAGAGCACGTCTGAACTC CAGTCACXXXXXXATCTCGTATGCCGTCTTCTG-3';

[0064] Sequence b:

[0065] 5'-ACACCGAGATTCTACACTCTTTCCCTACACGACGCTCTTCCGATCCTGCGTGTCTCCGACTCAGCTAXXXXXX-3';

[0066] Sequence ...

Embodiment 2

[0080] Example 2 Construction of Universal Gene Detection Library for Hereditary Familial Hypercholesterolemia

[0081] Samples from 10 patients with hereditary familial hypercholesterolemia were collected for library construction, using the entire coding region and variable splice region (20 bp extension from exon to intron) of LDLR, APOB, PCSK9 and LDLRAP1 genes as targets The primer pool in the region is subjected to multiple reaction PCR, and the sequencing adapter is connected to construct the library. The specific operation process is as follows:

[0082] (1) Nucleic acid extraction and quality inspection: after blood cells undergo nucleic acid extraction and quality inspection, they are required to meet certain quality control standards: DNA concentration: 10ng / μL; DNA purity: OD260 / 280 1.8-2.0, OD260 / 230>2; DNA Total starting amount: 20ng.

[0083] (2) Multiplex PCR primer design and amplification:

[0084] Design a primer pool based on the full coding region and var...

Embodiment 3

[0092] Example 3 Multi-platform sequencing verification and detection

[0093] Combined with the high-throughput sequencing platform Ion GeneStudio TM The S5 Plus platform and the Miseq DX platform perform DNA sequencing, and then detect point mutations (SNP) and small fragment insertion-deletion (InDel). The specific steps are as follows:

[0094] (1) After purification, the library was quality checked and quantified using Agilent 2100 and QUBIT 4.0. Library 2100 quality control map see Figure 2-3 , showing that the main peak of the library length fragment is around 400bp and the main peak of the library is a single sharp single peak. The results indicate that the two ends of the target gene fragment have been connected with universal high-throughput sequencing adapters. The library concentration was calculated according to the dilution factor. If the library concentration is higher than 1ng / uL, the subsequent experimental steps can be performed, and if the library concen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a construction method of a universal gene detection library for hereditary familial hypercholesterolemia and a kit. The construction method and the kit disclosed by the invention are based on a universal high-throughput sequencing joint, relate to LDLR, APOB, PCSK9 and LDLRAP1 gene mutation, can be compatible with various sequencing platforms including an Ion Torrent platform and an Illumina platform, and have the advantages of being simple, convenient and rapid in library building step, capable of saving cost, wide in application range and the like.

Description

technical field [0001] The invention relates to the field of gene detection, in particular to a method and kit for constructing a universal gene detection library for hereditary familial hypercholesterolemia. Background technique [0002] Hereditary Familial Hypercholesterolemia (FH) is a lipid metabolism disorder whose clinical and genetic characteristics were first identified, mainly manifested in serum low-density lipoprotein-cholesterol (LDL-C) levels Significantly elevated, and skin / tendon xanthomas. Clinically divided into two subtypes of homozygous familial hypercholesterolemia (HoFH) and heterozygous familial hypercholesterolemia (HeFH). The homozygous type is rare, with an incidence rate of one in a million. The low-density lipoprotein cholesterol (LDL-C) value of patients is usually 500-1200 mg / dL, which is 4 to 6 times that of normal people. Patients have multiple tendonitis Xanthelasma and premature atherosclerosis, severe coronary heart disease can occur in ad...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/6806C12Q1/6869C12Q1/6883C40B40/06C40B50/06
CPCC12Q1/6806C12Q1/6869C12Q1/6883C12Q2600/156C40B40/06C40B50/06C12Q2535/122C12Q2525/191
Inventor 曹彦东周洋扶媛媛杨颖张丽婷苏正稳
Owner ANNGEEN BIOTECHNOLOGY CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More