Molecular markers linked to qtl QTA-2B linked to tiller angle in wheat and its application
A molecular marker, wheat technology, applied in the field of molecular biology and crop genetics and breeding, can solve the problem of not many molecular markers, achieve accurate and efficient detection, high utilization value, and improve the efficiency of selection and identification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1 Obtainment of Wheat Tiller Angle QTL QTA-2B and Its Molecular Marker KASP-sicau1
[0043] (1) Using the wheat line '20828' as the female parent and the wheat variety 'SY95-71' as the male parent to cross, the hybrid F 1 , F 1 F 2 , at F 2 Using the single-ear transmission method, all the way to F 7 Generations, recombinant inbred lines containing 128 lines were obtained to form a genetic mapping population.
[0044] (2) Recombinant inbred line population tiller angle phenotype identification: analyze and identify the tiller angle of the recombinant inbred line at wheat maturity stage, remove the individual plants at both ends of each row, collect five individual plants with the same growth respectively, and calculate the tiller angle, And get the average value, representing the tiller angle of the line.
[0045] (3) 55K SNP chip analysis
[0046] a) DNA extraction: DNA of parent '20828', 'CN16' and recombinant inbred line population plants was extracted ...
Embodiment 2
[0062] Example 2 Application of Molecular Marker KASP-sicau1 in Selection and Control of Tiller Angle QTL QTA-2B
[0063] (1) The common wheat line 'K13-868' with a smaller tiller angle was used as the female parent, and the common wheat line 'SY95-71' with a larger tiller angle was used as the male parent to construct a recombinant inbred line, and randomly selected among the offspring lines 70 strains.
[0064] (2) Carry out KASP-sicau1 marker detection on the obtained 70 strains, the specific method is: extract the DNA of 70 strains; use it as a template, and perform PCR with the specific primer pair of molecular marker KASP-sicau1 as primers To amplify and perform a fluorescent readout, the primers are:
[0065] Primers on the FAM tag: (the underlined part is the FAM tag sequence)
[0066] 5'- GAAGGTGACCAAGTTCATGCT CCATGAACTCGTAACATGTTA
[0067] -3' (SEQ ID No.1)
[0068] Primers on the HEX tag: (the wavy part is the HEX tag sequence)
[0069] 5'- GAAGGTCGGAGTCAAC...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com