Application of elemicin to preparation of medicine for treating lysosomal storage diseases
A technology of lysosomal storage disease and elemin, which is applied in the field of biomedicine, can solve the problems that it cannot be used as a universal therapy for LSD, increases the risk of cancer, and has little benefit
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1: Phenotype identification of three lysosomal storage disease model cell lines used in the experiment
[0031] In order to screen small molecule libraries, three gene knockout model cell lines for lysosomal storage diseases were constructed in HeLa cells through the CRISPR-Cas9 system, namely GLAKO (GLA gene knockout) and HEXAKO (HEXA gene knockout). ), and NPC1KO (NPC1 gene knockout). The DNA sequences used for gene knockout to be transcribed into corresponding gRNA are: GLA: GCTCCCCAAAGAGATTCAGA; HEXA: TTTCCCCGCTTTCCTCACCG; NPC1: CTGGACACAGTAGCAGCAGG. Among them, the knockout of GLA resulted in the loss of 7bp of bases at the 234th bp of the exon of the gene on both chromosomes, resulting in frameshift, and the complete loss of GLA protein expression was confirmed by WB; the knockout of HEXA resulted in two chromosomes There was an extra base at 539bp of the exon of the gene above, which caused a frameshift, and the complete loss of HEXA protein expression was ...
Embodiment 2
[0034] Example 2: Screening of small molecule libraries
[0035] Through the screening of a small molecule library of natural extracts (TargetMol Natural Compound Library, L6000), from 850 kinds of natural small molecules, it is found that Elemicin has a positive effect on the phenotype of lysosomal storage disease at the cell level. Significantly improve the effect of small molecules.
[0036] The specific screening process is as follows:
[0037] Lysotracker (Thermo Fisher, catalog number L7528) was used to label lysosomes in WT and three lysosomal storage disease model cell lines. After 48 hours of treatment with small molecules at a concentration of 10 micromolar, the cells were detected by flow cytometry Intracellular lysotracker fluorescence is used to calculate the total intracellular lysosome volume. Among them, the drugs that caused the total volume of lysosomes to decrease by more than 20% in the three cell lines and did not cause obvious cell damage to WT cells entered t...
Embodiment 3
[0038] Example 3: Elemulin can significantly inhibit the phenotype of lysosomal storage disease cell lines
[0039] In HeLa cells of WT, GLAKO, HEXAKO, NPC1KO, each was treated with 10 micromolar elemani for 48 hours, and then lysotracker was used to label the intracellular lysosomes, and the cells were captured by live cell imaging and analyzed with ImageJ. The lysotracker fluorescence amount is used to quantify lysosome volume. The result is Figure 5 Shown: Elemulin did not affect the lysosomal volume in WT cells, but inhibited the increase in lysosomal volume in three LSD cell lines.
[0040] In HeLa cells of WT, GLAKO, HEXAKO, NPC1KO, treated with 10 micromolar elemidine for 48 hours, and then labeled with Philippine blue, the cholesterol in the cells was captured by live cell imaging and then analyzed by ImageJ. Philippine blue fluorescence is used to quantify the accumulation of cholesterol. The result is Image 6 Shown: Elemulin did not affect the amount of cholesterol in...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com