Wheat disease resistance and heading regulating gene tacok and its related biomaterials and applications
A biomaterial and genetic technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve problems such as lack and slow progress
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0110] The preparation method of the toothpick covered with Rhizoctonia graminearum: Put the toothpick section upright and stuff it into a small beaker, prepare MS liquid medium, pour it into the small beaker of the toothpick section, and put the preserved Rhizoctonia graminearum into the small beaker after sterilization. The mycelium block was inoculated into a beaker and incubated at a constant temperature of 25°C until the mycelium was densely covered with a toothpick.
[0111] Preparation method of fungus wheat grains covered with Rhizoctonia graminearum: prepare MS liquid medium, after sterilization, inoculate the mycelial block of newly cultivated Rhizoctonia graminearum into a triangular flask, and cultivate at a constant temperature of 25°C until the bacteria The silk is dense; then soak the wheat grains for 5-6 hours and boil for 20 minutes, fill up a 250-500 ml triangular flask, insert the dense mycelia liquid on it, shake well, and cultivate at a constant temperature...
Embodiment 1
[0112] Example 1. Cloning of wheat protein TaCOK resistant to sheath blight and its coding gene and its expression analysis induced by sheath blight
[0113] 1. Cloning of wheat protein TaCOK resistant to sheath blight and its coding gene
[0114] The inventors of the present invention isolated and cloned a disease resistance related wheat protein from sheath blight resistant wheat germplasm CI12633, the amino acid sequence of which is shown in SEQ ID No.2, and named it TaCOK protein. The gene encoding TaCOK protein is named TaCOK gene, and its nucleotide sequence is shown in SEQ ID No.1.
[0115] The specific cloning method is as follows:
[0116] Total RNA was extracted from the stems of wheat CI12633 inoculated with Rhizoctonia cerealis WK207 hyphae, and the extracted RNA samples were reverse-transcribed to synthesize the first-strand cDNA synthesis kit according to the procedure of Invitrogen's first-strand cDNA synthesis kit. A strand of cDNA was used as a template for ...
Embodiment 2
[0129] Example 2. Obtaining, molecular and disease resistance identification of transgenic TaCOK wheat resistant to sheath blight
[0130] 1. Construction of recombinant expression vector
[0131] Construct the complete ORF sequence of TaCOK gene into pWMB123, the specific operation is as follows:
[0132] 1. Use a primer pair consisting of TaCOK-TV-F and TaCOK-TV-R.
[0133] TaCOK-TV-F: 5′- TTCTGCAGGTCGACTCTAGA ATGGAGAAGACGACAGGGAT-3' (the sequence indicated by the underline is the homologous sequence of the vector);
[0134] TaCOK-TV-R: (The sequence indicated by the underline is the homologous sequence of the vector, and the sequence indicated by the box is the 6×His tag coding sequence).
[0135] 2. Using the DNA fragment shown in SEQ ID No.1 as a template, the primer pair consisting of TaCOK-TV-F and TaCOK-TV-R is used for PCR amplification under the action of the high-fidelity amplification enzyme PRIMERSTAR (TAKARA company) , to obtain the PCR amplification pro...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap