Application of a kind of galectin-9 derived from mandarin fish in the preparation of antibacterial agent
A technology of galectin and mandarin fish, applied in medical preparations containing active ingredients, antibacterial drugs, and resistance to vector-borne diseases, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Preparation and purification of mandarin fish galectin-9 recombinant protein (rScGal9):
[0029] The head kidney tissue of mandarin fish was separated, and the head kidney RNA sample of mandarin fish was obtained by the traditional Trizol (Ambion) extraction method, and the cDNA was obtained by reverse transcription using a commonly used reverse transcription kit (Thermo Scientific). Using the head kidney cDNA as a template, The forward primer is: ScGal9-F1 GACAATGGCTTTTAATCAGCAG; the reverse primer is ScGal9-R1 CTGGATCTCTACACCATCACAGTG, and the full-length ORF sequence of mandarin fish galectin-9 was obtained by PCR reaction using the high-fidelity DNA polymerase produced by Novizyme ( shown in SEQ ID NO.2). After Shanghai Sangon Biotech’s sequencing is correct, design primers containing restriction enzyme sites, clone a BamHI restriction site at the 5’ end, and clone a HindIII restriction site at the 3’ end, the specific forward primer is ScGal9F2>CGCGGATCCATGGCTTTTA...
Embodiment 2
[0033] Detection of Agglutination Bacterial Activity of Galectin-9 Recombinant Protein
[0034] Bacteria: Aeromonas hydrophila AH-1, Streptococcus agalactiae XQ-1, Escherichia coli TOP10, Staphylococcus aureus CICC10384.
[0035] The specific experimental steps are as follows:
[0036] 1. Activate the above four kinds of bacteria on the agar solid plate medium by means of "Z" streaking, place the plate in a 28°C incubator for 24 hours, and then pick the bacterial monoclonal colony on the plate and place it in the liquid In the culture medium, culture in a constant temperature shaker at 28°C until the logarithmic growth phase (OD value 0.5).
[0037] 2. At room temperature, centrifuge at a speed of 5000r / min for 10 minutes to collect bacteria, add the same volume of sterile PBS buffer to resuspend, centrifuge again to collect bacteria, remove the supernatant, add the same volume of sterile PBS buffer to resuspend hanging.
[0038] 3. Take out the galectin-9 (rScGal9) recombina...
Embodiment 3
[0045] Detection of antibacterial activity of mandarin fish galectin-9 recombinant protein (rScGal9):
[0046] Bacteria: Streptococcus agalactiae XQ-1, Edwardsiella lentus PPD130 / 91 and Flavobacterium columnar G4
[0047] Specific steps are as follows:
[0048] 1. Take out the preserved strains of the above four bacteria from the refrigerator at -80°C, activate the above four bacteria on the agarose solid plate medium by "Z"-shaped streaking, and place the plate in a 28°C incubator After culturing for 24 hours, the bacterial monoclonal colonies on the plate were picked and placed in respective liquid medium, and cultured in a constant temperature shaker at 28°C until the logarithmic growth phase (OD value 0.5).
[0049] 2. Take out the mandarin fish galectin-9 recombinant protein (rScGal9) solution from the -80°C refrigerator 30 minutes in advance and put it on ice, because the mandarin fish galectin-9 recombinant protein (rScGal9) has Ca 2+ Dependence, so prepare 1M CaCl2 s...
PUM
Property | Measurement | Unit |
---|---|---|
concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap