Dye fluorescent quantitative primer for detecting positive reovirus and kit
A technology of fluorescence quantification and kits, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc. It can solve the problems of unsatisfactory accuracy, large gene sequence differences, and inapplicability. The effect of wide detection range, few operation steps and convenient identification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Primer design
[0034] According to the published strain sequences of MRV genes registered in NCBI at home and abroad (AF368033.1, DQ664184.1, DQ997719.1, EF494435.1, GQ468266.1, GU196306.1, HM159613.1, JN799426.1), the application Beacon Designer 7.7 software designed specific primers for the L1 gene of MRV, and all primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd.
[0035] Upstream primer MRV F: TATATTGATGCTCTAAATCGTGTG, SEQ ID NO: 1;
[0036] Downstream primer MRV R: TTCTGGCTTGGCTATCTCC, SEQ ID NO:2.
Embodiment 2
[0038] Establishment of a fluorescent quantitative RT-PCR method for detection of mammalian orthoreovirus:
[0039] The method includes the following steps:
[0040] (1) RNA extraction of samples to be tested:
[0041] Fully resuspend and mix the positive stool sample with PBS (1:5), freeze and thaw three times in the refrigerator at -80°C, centrifuge at 3,000rpm for 10min, discard the precipitate, then centrifuge at 12,000rpm for 30min, take the supernatant, and follow the Trizol Reagent Total RNA was extracted according to the instructions, and cDNA was synthesized according to the instructions of the reverse transcription kit, and stored at -20°C for future use. Bacterial DNA was extracted by the phenol-chloroform method and stored at -20°C for future use.
[0042] (2) Add the extracted RNA to the reverse transcription kit for reverse transcription to obtain the cDNA template:
[0043]The reverse transcription step is as follows: Mix 4 μL of RNA template, 4 μL of No. 1 5...
Embodiment 3
[0047] Optimization of annealing temperature, primer concentration and probe concentration, determination of sensitivity, stability and specificity
[0048] (1) Optimization of the annealing temperature: the annealing temperature in the MRV F / R primer reaction conditions is set at 48°C-56°C, observe the amplification peak diagram of the fluorescent quantitative PCR instrument, and select the one with the smallest CT value as the optimal annealing temperature, The optimum annealing temperature of the present invention is 56°C.
[0049] (2) Optimization of primer concentration: 20 μL reaction system for PCR, 0.2 μL to 1 μL each for upstream and downstream primers. The primer concentration with the smallest CT value was selected as the optimal primer concentration, and the optimal primer concentration was 0.5 μL.
[0050] (3) Sensitivity evaluation:
[0051] Cloning transformation and recombinant positive plasmid: RT-PCR amplifies the target gene, and conducts electrophoresis o...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com