Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Aspergillus awamori, its agent and its application

A technology of Aspergillus awamori and bacterial agent, which is applied in the field of Aspergillus awamori, bacterial agent and its application. It can solve problems that need to be studied, and achieve the effect of increasing the weight loss rate of straw, increasing the fermentation temperature, and good composting effect

Active Publication Date: 2021-09-21
SINOCHEM AGRI LINYI R&D CENT CO LTD
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, microorganisms suitable for straw composting are still to be studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aspergillus awamori, its agent and its application
  • Aspergillus awamori, its agent and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 strain isolation and screening

[0032] (1) Isolation of cellulase-producing strains: collect rotten straw and livestock manure in the test field of Sinochem Agriculture Linyi R&D Center, weigh 1g into 100ml sterile water, shake at 150rpm, 30°C for 30min, and then carry out gradient diluted to 10 4, select 3 gradients for coating, and each gradient has 3 parallels. After culturing in a 30°C incubator for 2 days, select strains with different colony forms to streak on the PDA medium, and observe the growth of the colonies regularly. Then, the plate streak method was used to purify the strains, and they were numbered and stored separately.

[0033] (2) Screening of cellulase-producing strains: Prepare PDA medium (adding sodium carboxymethyl cellulose) by plate hydrolysis circle method, transplant the strains isolated and preserved in (1) into the center of the plate with a toothpick, and keep at 30°C After incubating at constant temperature for 48 hours, absor...

Embodiment 2

[0048] Identification of embodiment 2 B-13 bacterial strain

[0049] (1) Microbiological characteristics: On PDA medium, the colony grows rapidly, is flat, has a powdery texture, dark brown surface, no exudate, and the opposite side of the colony is orange-yellow in varying degrees, with radial grooves, and the spores are spherical or Near spherical, diameter 3.5 ~ 5μm, rough wall.

[0050] (2) Molecular biological characteristics:

[0051] The ITS sequence of the strain is as follows, and the phylogenetic tree can be found in figure 1 . Thus, the strain was identified as Aspergillus awamori.

[0052] AACGGGAGGGCGGGTCTTTGGGCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGT...

Embodiment 3

[0053] The preparation of embodiment 3 microbial bacterial agents

[0054] Step 1: Inoculate the Aspergillus awamori B-13 strain and the bacterium cake preserved in the plate into an Erlenmeyer flask containing 250ml of PDA culture solution, and culture it in a constant temperature incubator at 30°C and 170rpm for 3 days.

[0055] Step 2: Inoculate the above-mentioned fermented bacteria liquid into a solid medium at a ratio of 5% (v / w), culture it at 28°C for three days, dry it and pulverize it, and mix it with wheat bran to form a viable count of 5 billion / g Aspergillus awamori B-13 bacterial powder, that is, the Aspergillus awamori B-13 bacterial agent for composting. The formula of the solid medium is: peat soil 25%, wheat bran 10%, soybean meal 15%, potato extract 20%, glucose 5‰, sodium chloride, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, calcium carbonate 1‰ each, replenish water to 100%, pH adjusted to 7.0.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The present invention proposes microorganisms, inoculants, and preparation methods and applications thereof. The microorganisms are Aspergillus awamori, which was deposited in the General Microbiology Center of the China Microorganism Culture Collection Management Committee on October 15, 2019, and the deposit number is CGMCC No.18595. The microorganism of the invention has good cellulose decomposing ability, can be effectively used in straw composting, obviously accelerates the heating rate in the early stage of composting, increases the fermentation temperature, increases the weight loss rate of straws after composting, reduces the C / N content, and reduces the degree of composting maturity. High, suitable for large-scale applications.

Description

technical field [0001] The present invention relates to the field of biology. Specifically, the present invention relates to Aspergillus awamori, bacterial agents and applications thereof. Background technique [0002] With the advancement of farming technology, the output of straw is increasing, but because the utilization rate of straw is not high, most of it is incinerated, resulting in waste of resources and environmental pollution. As a good raw material for organic fertilizer production, straw has not been fully utilized due to the lack of mature and efficient conversion technology. Returning the straw to the field can make full use of the nutrient resources in the straw and improve the soil. The straw after returning to the field will decompose under the action of soil microorganisms, and the cellulose, hemicellulose and lignin in the straw will be converted into simple substances that are easy for plants to absorb. Compounds can improve soil physical and chemical p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/14C05F17/20C05F17/70C05G3/80C12R1/665
CPCC05C9/00C05F17/00C12N1/14C12N1/145C12R2001/665C05F11/00C05F11/08Y02W30/40
Inventor 李延锋柴彦亮刘杰邱鹏飞王子浩
Owner SINOCHEM AGRI LINYI R&D CENT CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com