Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of human TTLL4 gene and related products

A gene and application technology, applied in the application of human TTLL4 gene and related products

Pending Publication Date: 2020-04-21
THE PEOPLES HOSPITAL SHAANXI PROV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, its role in lung cancer has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of human TTLL4 gene and related products
  • Application of human TTLL4 gene and related products
  • Application of human TTLL4 gene and related products

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0109] Example 1 Preparation of RNAi lentivirus against human TTLL4 gene

[0110] 1. Screening for effective siRNA targets against the human TTLL4 gene

[0111] Retrieve TTLL4 (NM_014640) gene information from Genbank; design effective siRNA targets for TTLL4 gene. Table 1-1 lists the screened effective siRNA target sequences against TTLL4 gene.

[0112] Table 1-1 is targeted at the siRNA target sequence of human TTLL4 gene

[0113] SEQ ID NO TargetSeq(5'-3') 1 CCTCATTCATCAGTCTCTTTT

[0114] 2. Preparation of lentiviral vector

[0115] Aim at the siRNA target (take SEQ ID NO: 1 as an example) to synthesize a double-stranded DNA Oligo sequence (Table 1-2) with Age I and EcoR I restriction sites at both ends; Dicer acts on the pGCSIL-GFP vector (provided by Shanghai Jikai Gene Chemical Technology Co., Ltd.) to linearize it, and agarose gel electrophoresis identifies the digested fragment.

[0116] Table 1-2 Double-stranded DNA Oligo with sticky ends co...

Embodiment 2

[0134] Example 2 Real-time fluorescent quantitative RT-PCR method to detect gene silencing efficiency

[0135] A549 human lung cancer cells and NCI-H1299 human non-small cell lung cancer cells in the logarithmic growth phase were respectively trypsinized to make cell suspensions (the number of cells was about 5×10 4 / ml) were inoculated in 6-well plates, and cultured until the cell confluency reached about 30%. According to the multiplicity of infection value (A549:10, NCI-H1299:5, this multiplicity of infection is used in the following contents of the manual), add an appropriate amount of the lentivirus prepared in Example 1, and replace the medium after 24 hours of cultivation. After reaching 5 days, the cells were harvested. Total RNA was extracted according to the instruction manual of Invitrogen's Trizol. According to the M-MLV instruction manual of Promega Company, RNA was reverse-transcribed to obtain cDNA (see Table 2-1 for the reverse transcription reaction system, ...

Embodiment 3

[0143] Example 3 Celigo assay detects the proliferation ability of tumor cells infected with TTLL4-shRNA lentivirus

[0144] The A549 human lung cancer cells and NCI-H1299 non-small cell lung cancer cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in 6-well plates, and cultured until the cell confluency reached about 30%. According to the multiplicity of infection, an appropriate amount of virus was added, and the culture medium was replaced after 24 hours of culture. After the infection time reached 3 days, the cells of each experimental group in the logarithmic growth phase were collected. The complete medium was resuspended into a cell suspension (2×10 4 / ml), A549 was inoculated in a 96-well plate at a cell density of about 2000 cells / well, and NCI-H1299 800 cells / well. 5 replicate wells in each group, 100 μl per well. After laying the board, place at 37°C, 5% CO 2 Incu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biomedical research, and particularly relates to application of a human TTLL4 gene as a target in preparation of lung cancer treatment drugs. Results of wide anddeep research show that proliferation of lung cancer cells can be effectively inhibited, cell apoptosis is promoted and the growth process of the lung cancer can be effectively controlled after expression of the human TTLL4 gene is down-regulated by adopting an RNAi method. An siRNA or a nucleic acid construct and a lentivirus containing the siRNA sequence provided by the invention can specifically inhibit the proliferation rate of lung cancer cells, promote apoptosis of the lung cancer cells, inhibit cloning of the lung cancer cells, inhibit invasion of the lung cancer cells, inhibit metastasis of the lung cancer cells and inhibit growth of the lung cancer cells; therefore, a new direction is opened up for lung cancer treatment.

Description

technical field [0001] The invention belongs to the field of biomedical research, and specifically relates to the use of human TTLL4 gene and related products. Background technique [0002] TTLL4 belongs to the TTLL protein family, has a TTL homology domain, and can catalyze the linkage of various amino acids, such as tyrosinylation, polyglycosylation and polyglutaminylation (Westermann S, Weber K. Post-translational modifications regulate microtubule function. Nat Rev Mol Cell Biol 2003;4:938–47). In recent years, some TTLL family members have been confirmed to have polyglutamic acid tubulin and microtubule-associated protein activity (Janke C, Rogowski K, Wloga D, et al.Tubulin polyglutamylase enzymes are members of the TTL domain protein family.Science 2005;308:1758–62.). Polyglutaminylation is a new class of post-translational modification that forms variable-length glutamate side chains on target proteins and was first identified on tubulin. Polyglutamylation may aff...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/867A61K45/00A61K31/713A61P35/00A61P11/00
CPCC12N15/1137C12N15/86A61K45/00A61P35/00A61P11/00C12Y603/02C12N2310/14C12N2740/15043C12N2800/107C12N2310/531
Inventor 魏益群李静杨拴盈杨淑梅曹燕飞
Owner THE PEOPLES HOSPITAL SHAANXI PROV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com