Novel coronavirus visual constant-temperature rapid detection kit
A coronavirus and kit technology, which is applied in the field of visual constant temperature (nucleic acid extraction-free) rapid detection kits for new coronaviruses, can solve the problems of difficult amplification and inability to amplify long-chain RNA, and achieve accurate detection and good application prospects. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1 Acquisition of Primers for Novel Coronavirus Constant Temperature Rapid Nucleic Acid Amplification Technology
[0043] In this example, for the highly conserved fragment (SEQ ID NO:7) of the new coronavirus (2019-nCoV), according to the principle of LAMP primer design, the LAMP Desiner2.0 software was used to design 6 primer combinations, and the primers were analyzed by RNAMAN. Three candidate primer combinations were picked out (Table 1).
[0044]
[0045]Due to the presence of non-specific amplification in both group II and group III primer combinations, the present invention finally determines that the 6 specific primers in the kit for detecting novel coronavirus 2019-nCoV are the following combinations (SEQ ID NO: 1-6) :
[0046] Outer forward primer Co5-153-F3: AACATGGAGGAGGTGTTG
[0047] Outer reverse primer Co5-153-B3: CAAGTAGAACTTCGTGCTG
[0048] Inner forward primer Co5-153-FIP: AAACACAACTACCACCCACTTTTGCCATGCAAGTTGAATC
[0049] Inner reverse p...
Embodiment 2
[0052] Example 2 Establishment of New Coronavirus Constant Temperature Rapid Nucleic Acid Amplification Technology Method
[0053] Using the primer combination determined in Example 1, perform constant temperature and rapid nucleic acid amplification technology on the positive plasmid of the new coronavirus.
[0054] Add 20 µL ddH to the bottom of the reaction tube 2 O, add 20 µL of OG reaction reagent, gently pipette once with the tip of the pipette, and mix well. Then add 20 μL of sample soaking solution (throat swab soaking solution sample) to the reaction tube, mix well, and finally add 10 μL of LOG dye (purchased from Harbin Xinhai Genetic Testing Co., Ltd.).
[0055] The preparation method of the OG reaction reagent is as follows: 50 mg of the OG freeze-dried reaction reagent is dissolved in 650 μl of reaction buffer to obtain the OG reaction reagent.
[0056] Wherein, the composition of reaction buffer is as follows:
[0057] Tris-HCl 20mM, pH8.8
[0058] MgSO 4 6...
Embodiment 3
[0070] Embodiment 3 Sensitivity experiment
[0071] The new coronavirus positive plasmid was diluted 10 times, and the dilution was 10 -1 to 10 -7 Seven dilutions were performed according to the method established in Example 2 to perform the constant temperature rapid nucleic acid amplification technology to determine the sensitivity of the constant temperature rapid nucleic acid amplification detection technology established in the present invention.
[0072] The results of the sensitivity analysis showed that the T7P primer (5'- AAGCTTCTAATACGACTCACTATAGGGAG-3') and the pJET-R primer (5'- AAGAACATCGATTTTCCATGGCAG -3') Amplify the plasmid containing the viral nucleic acid sequence, and the amplified product ( figure 1 ) was inserted into the multiple cloning site of the pJET plasmid, and the 2019 nCoV-pJET standard plasmid was constructed as a detection template.
[0073] PCR amplification system: 5×G5 PCR Mix 10 μl, 10 μM T7P 1 μl, 10 μM pJET-R 1 μl, plasmid containing vi...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap