Alpha-amyrin synthetase gene EjAAS1 and application thereof
A kind of aroma tree essence, synthetic enzyme technology, applied in application, genetic engineering, plant genetic improvement and other directions
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1 Cloning of Loquat EjAAS1 Gene cDNA Sequence
[0034] 1. Experimental method
[0035] 1. Sample collection
[0036] The leaf samples of "Zaozhong No. 6" during the five developmental stages of loquat were collected from the "Zaozhong No. 6" production tree planted in the loquat germplasm resource nursery of South China Agricultural University. Fresh samples were quickly frozen in liquid nitrogen and stored in a refrigerator at -80°C.
[0037] 2. RNA extraction
[0038] Use EASYspin Plus Plant RNA Rapid Extraction Kit (Adelaide) to extract RNA from the ground fruit samples according to the instructions. The specifics are as follows: Take 1.0mL RLT lysate into a 1.5mL centrifuge tube, and add 100mg of ground fruit sample powder , Shake vigorously for 20s, then lyse at 55°C for 20min; centrifuge the lysate at 13000rpm for 5-10min; take the supernatant, transfer to a new centrifuge tube, and add half of the supernatant volume of absolute ethanol, gently pipette to mix ; A...
Embodiment 2
[0052] Example 2 Comparison of triterpene acid content in different tissues of loquat and analysis of EjAAS1 expression pattern
[0053] 1. Experimental method
[0054] Each loquat tissue sample was collected according to the method in Example 1, RNA was extracted and cDNA was synthesized. EjACT was used as an internal reference (forward: CTTTCCCTCTATGCCAGTG and reverse: CAAGGTCAAGCCTCAAGAT) to analyze the expression of EjAAS1 in various tissues and different developmental stages (quantitative primer pair: forward: CAGCTCAAGACAGTACAAATTTAGT; reverse: CAATTGGCCGTTCATT AACAC). Using cDNA of each period as a template, use iTaqTM universal GreenSupermix (Bio-Rad), qPCR reaction was performed on the LightCycler 480 (Roche) fluorescent quantitative PCR machine. Amplify EjACT as an internal reference gene for loquat gene expression to normalize gene expression. 10.0μl mixed solution is 95℃60s; 95℃10s, 60℃20s, 72℃15s, repeated 39 times; the dissolution curve is analyzed according to the...
Embodiment 3
[0058] Example 3 Construction of EjAAS1 gene transient vector and transient transformation of tobacco leaves
[0059] 1. Experimental method
[0060] EjAAS1 was subcloned into 62SK transient expression vector with cgctctagaactagtggatcc (BamH I) ATGTGGAAGATCAAGTTTGGAGAGG and gataagcttgatatcgaattc (EcoRI) TCAAGCGATCTTTTTGATAGGCA primer pair. The specific vector construction is: using Gibson Master Mix and corresponding endonucleases (BamH I and EcoR I, purchased from New England Bio labs) were incubated at 37°C for 1 hour to linearize the 62SK vector. The digested product was purified using Gel DNA Mini Recovery Kit (Magen). Use ClonExpress one-step directional cloning seamless cloning kit to connect the purified enzyme digestion product to the target vector. The reaction system contains 1μl purified and recovered PCR amplification product, 1μl linearized vector, 2μl 5×CE II buffer, 1μl Exnase TM II and 4μl sterile water. The reaction system was reacted at 37°C for half an hour ...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap