Lipid hydroperoxide lyase, as well as gene and application thereof
A lipid hydroperoxide and lyase technology, applied in the field of lyase gene, can solve the problem that the mechanism of aroma components in black tea is not completely clear
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
experiment example 1
[0042] Experimental example 1 Differences in the expression of lipid hydroperoxide lyase genes CsHPL1 and CsHPL3 in different tissues of Shuchazao and black tea during processing
[0043]1. Expression differences of lipid hydroperoxide lyase genes CsHPL1 and CsHPL3 in different tissues of Shuchazao
[0044] The roots, stems, flowers, fruits, buds, first leaf, second leaf, and third leaf of Shucha early plants were picked respectively, and the expression levels of CsHPL1 and CsHPL3 in each sample were detected by high-throughput sequencing method, as shown in image 3 Shown is the histogram of the expression levels of CsHPL1 and CsHPL3 in different tissues of the present invention, image 3 A is the expression level of CsHPL1 in each sample, image 3 Middle B is the expression level of CsHPL3 in each sample. In the figure, L1 means one leaf, L2 means two leaves, L3 means three leaves, FL means flower, FR means fruit, S means stem, R means root, B means bud, you can see It was...
experiment example 2
[0047] Experimental example 2 Cloning of lipid hydroperoxide lyase genes CsHPL1 and CsHPL3
[0048] 1. Preparation of DH5α Escherichia coli containing gene CsHPL1 or CsHPL3 sequence
[0049] (1) Specific primers
[0050] The specific primer sequence of CsHPL1 is as follows (the underlined part is the restriction enzyme cutting site):
[0051] F (SEQ ID NO.5):
[0052] C GGATCC ATGTCGGCAGTGATGGCGAAAATG BamH1
[0053] R (SEQ ID NO.6):
[0054] G GAATTC TCACTTAGCTTTTTCGACGGC EcoR1
[0055] The specific primer sequence of CsHPL3 is as follows (the underlined part is the restriction enzyme cutting site):
[0056] F (SEQ ID NO. 7):
[0057] T GGATCC ATGGAGGCCATCTCACTGTCTCT BamH1
[0058] R (SEQ ID NO. 8):
[0059] C AAGCTT CTAGCACGCTTGGAGGCGAATT Hind3
[0060] (2) According to the instructions of Plant Total RNA Extraction Kit and First Strand cDNA Synthesis Kit (purchased from TIANGEN, Cat#DP441), extract the total RNA of the tea tree sample, and reverse transcribe...
experiment example 3
[0074] Experimental Example 3 Preparation of recombinant bacteria containing CsHPL3 and expression and purification of target protein
[0075] 1. Preparation of recombinant bacteria containing CsHPL3
[0076] The recombinant plasmid CsHPL3-PET28A constructed in Experimental Example 2 was introduced into Escherichia coli BL21 (DE3) to obtain recombinant bacterium A; the pET-28a (+) vector was introduced into Escherichia coli BL21 (DE3) to obtain recombinant bacterium B; The recombinant plasmid CsHPL3-PB2GW7 constructed in was introduced into Agrobacterium GV3101 to obtain recombinant bacterium C; the PB2GW7(+) vector was introduced into Agrobacterium GV310 to obtain recombinant bacterium C.
[0077] 2. Expression and purification of the target protein in recombinant bacteria A and B
[0078] Inoculate the above-mentioned recombinant bacteria A and B into the liquid LB medium containing 50 mg / L kanamycin, culture at 37°C with shaking at 180 rpm until OD 600nm = 0.6. Then, IPT...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com