Composition and method for improving recombination efficiency of transgenic cells
A technology of transgenic cells and compositions, applied in the field of transgenic, can solve the problems of low efficiency of single-nick Cas9 nuclease, ineffective gene sequence, TALEN off-target, etc., and achieve the effect of improving recombination efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0076] Example 1: Method for preparing Fars2 gene point mutation rats using CRISPR-Cas9 system
[0077] Specific operations include:
[0078] 1. sgRNA target design
[0079]Extract the 50 bp sequences of the upstream and downstream of the rat Fars2 gene D142 in the NCBI database, as follows, and design the target site:
[0080] ACTTCGATAGCCTGCTAATCCCAGCTGACCACCCCAGCAGGAAGAAGGGGGACAA CTATTACTTGAATCGGGGACACATGCTGAGAGCACACACATCAGCACA (SEQ ID NO.: 1).
[0081] Meet 5'-NNNNNNNNNNNNNNNNNNNN NGG There are 10 in -3', because the gene has homozygous lethality, the designed gRNA uses a more specific mutant Cas9 (Cas9_D10A) to reduce the lethality caused by off-target. Cas9_D10A requires a pair of head-to-head gRNAs to recognize and cut double-stranded DNA. Since the mutation point is D142Y, if the designed gRNA pair does not contain D142, the gRNA will continue to cut after recombination, and no specific positive results will be obtained. Considering For this question, only gRNA pa...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com