Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene, gene fragment, corresponding dsRNA for regulating synthesis of sex pheromone of Blattella germanica and preparation method and application thereof

A technology of German cockroaches and gene fragments, applied in the field of dsRNA and its preparation, to achieve the effects of reducing content and release, good application potential, and reducing protein expression

Active Publication Date: 2019-11-22
GUANGMEIYUAN R & D CENT KEY LAB OF INSECT DEVELOPMENTAL BIOLOGY & APPL TECH SOUTH CHINA NORMAL UNIV MEIZHOU +1
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no relevant report on the control of cytochrome P450 involved in the synthesis of sex pheromone in the German cockroach

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene, gene fragment, corresponding dsRNA for regulating synthesis of sex pheromone of Blattella germanica and preparation method and application thereof
  • Gene, gene fragment, corresponding dsRNA for regulating synthesis of sex pheromone of Blattella germanica and preparation method and application thereof
  • Gene, gene fragment, corresponding dsRNA for regulating synthesis of sex pheromone of Blattella germanica and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 2

[0034] Example 2 of the present invention is: the acquisition of the CYP4PC1 gene fragment of Blattella germanica and its corresponding dsRNA:

[0035] 1. Synthesis of primers

[0036] Utilize the NCBI database Primer-BLAST to design specific primers for the CYP4PC1 gene fragment, including primer pair: AGAAGATGTGCAACTCGGTGA (SEQ ID No.5) and CTCCGTTTTCTGGTCGAAGGA (SEQ ID No.6) and primer pair: TAATACGACTCACTATAGGGAGAAGATGTGCAACTCGGTGA (SEQ ID No.7) and TAATACGACTCACTATAGGGCTCCGTTTTCTGGTCGAAGGA (SEQ ID No. 8). The above primer fragments were synthesized by Qingke Biotech (Guangzhou).

[0037] 2. Obtaining the CYP4PC1 gene fragment

[0038] With the recombinant plasmid containing SEQ ID No.1 as a template, use the primers shown in SEQ ID No.5 and SEQ ID No.6 (pairing use) respectively with nucleotide sequences to carry out PCR amplification and obtain the CYP4PC1 fragment (its nucleoside The acid sequence is shown in SEQ ID No.3). The amplified CYP4PC1 gene fragment was clo...

Embodiment 3

[0045] Embodiment three of the present invention is: the application of a P450 gene regulating the synthesis of sex pheromones of German cockroaches in the control of German cockroaches:

[0046] One, the dsRNA that can specifically inhibit the P450 gene in the German cockroach injection embodiment two

[0047] Sixty female Blattella germanicas within 12 hours of eclosion were selected and randomly divided into two groups of 30 in each group. The treatment group was injected with dsCYP4PC1, and the control group was injected with the corresponding dsRNA fragment (dsMuslta) of the mouse lymphotoxin protein gene. Inject 2 μL dsRNA (6 μg) from the abdominal internode pleats with a microinjector, repeat the injection of the same dose of dsRNA on the second and fourth day to maintain the continuous inhibitory effect on the target gene, inject three times in total, and feed under normal conditions after injection .

[0048] 2. Validation of dsRNA interference effect on P450 gene ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene, a gene fragment, a corresponding dsRNA that regulates the synthesis of sex pheromone of Blattella germanica and a preparation method and application thereof. The nucleotide sequence of the gene that regulates the synthesis of sex pheromone of Blattella germanica is as shown in SEQ ID No.1. The nucleotide sequence of the gene fragment is as shown in SEQ ID No.3. Introduction of dsRNA synthesized using the fragment as a template into female Blattella germanica can significantly inhibit the expression level of CYP4PC1 gene, leading to the reduction of methyl ketonesex pheromone synthesis. Finally, the courtship behavior of some male individuals of Blattella germanica disappears. The invention provides a potential molecular target for the management strategy based on cockroach mating and reproduction.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a gene for regulating the synthesis of sex pheromone of the German cockroach, a gene fragment, a corresponding dsRNA, a preparation method and application thereof. Background technique [0002] German cockroach is one of the most common worldwide household pests in the order Blattata. It is small in size and often lives in crevices and corners. It can widely spread a variety of pathogenic microorganisms, carry a large number of allergens and induce asthma, which seriously threatens human health. . Due to the tenacious vitality and amazing fecundity of the German cockroach, the female can lay eggs multiple times after a single mating, and each egg sheath can hatch about 40 nymphs. This super fecundity often makes its population The number has grown rapidly in a short period of time. In addition, German cockroaches are heterophagous and prone to resistance to commonly used pesticides...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C12N15/113C12N15/10A01N57/16A01P7/04
CPCA01N57/16C07K14/43563C12N15/113
Inventor 李胜陈楠
Owner GUANGMEIYUAN R & D CENT KEY LAB OF INSECT DEVELOPMENTAL BIOLOGY & APPL TECH SOUTH CHINA NORMAL UNIV MEIZHOU
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More