S-adenosylmethionine synthetase mutant and high-throughput screening method thereof

A technology of adenosylmethionine and mutants, applied in botany equipment and methods, microorganism-based methods, biochemical equipment and methods, etc., can solve the problem of low catalytic activity

Active Publication Date: 2019-08-27
ZHEJIANG UNIV
View PDF6 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

By comparing the enzymatic properties of MAT from different sources, we found that MAT generally has the problem of low catalytic activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • S-adenosylmethionine synthetase mutant and high-throughput screening method thereof
  • S-adenosylmethionine synthetase mutant and high-throughput screening method thereof
  • S-adenosylmethionine synthetase mutant and high-throughput screening method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Embodiment 1: Construction of eMAT recombinant bacteria

[0025] Select the MAT derived from Escherichia coli K12, use PCR technology, and use the E.coli K12 genome as a template to

[0026] metK-F:5'-GATCC GAATTC ATGGCAAAACACCTTTTTACG-3' (SEQ ID NO.3) and metK-R:5'-GTG CTCGAG TTACTTCAGACCGGCAGCAT (SEQ ID NO.4) was used as a primer to amplify the metK gene, and EcoR I and Xho I restriction endonuclease sites (underlined) were introduced at its 5' end and 3' end respectively. The PCR reaction system (50 μL) was: 25 μL of 2×PrimeSTAR Max Premix, 1 μL of template DNA, 1 μL of upstream and downstream primers, and 22 μL of sterile water. The PCR reaction conditions are: 98°C for 5 min; 98°C for 10s, 60°C for 5s, 72°C for 10s, cycle 30 times; 72°C for 5min. Verify the PCR amplification product with 1% agarose gel electrophoresis, when the target band size meets the size of the coding SEQ ID NO.1 ( figure 1 ), use PCR product recovery reagents and perform product recover...

Embodiment 2

[0027] Example 2: Establishment of eMAT catalytic activity transformation high-throughput screening method

[0028] Under acidic conditions, Pi can react with ammonium molybdate to form a blue complex. Malachite green can increase the color reaction of the complex, so that it has an obvious absorption peak at 620nm. Therefore, this chromogenic method is considered as a method for high-throughput screening. In order to ensure the sensitivity and accuracy of the screening process, the factors that may affect the color development in the experiment should be optimized first.

[0029] Using 100mM Tris-HCl as a control for color development, it was found that ATP would affect the color development ( figure 2 ). When the ATP concentration is lower than 2mM, OD 620 Increases linearly with increasing ATP concentration. But with the standard curve of Pi ( image 3 ), its slope is only 1 / 57. According to the fitting curve Y=0.18X+0.26, when ATP changes by 0.06mM, OD 620 The var...

Embodiment 3

[0033] Example 3: Construction and high-throughput screening of mutant libraries

[0034] Using the eMAT coding gene as a template, at 0.05mM, 0.04mM, 0.2mM Mn 2+ Error-prone PCR library construction was carried out under the following conditions, and 10 single colonies were randomly selected for sequencing, and it was found that only when Mn 2+ When the concentration is 0.04mM, the base mutation rate meets the requirements for error-prone PCR library construction (Table 2). The mutant library was initially screened by a high-throughput screening method, and 8 ODs were obtained 620 mutants at least 0.2 higher than controls. The 8 mutants were re-screened, and finally a mutant (R74H) with significantly higher specific enzyme activity than wild-type eMAT was obtained.

[0035] Table 2 Mn in PCR system 2+ The relationship between concentration and mutation rate

[0036]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a high-throughput screening method for catalytic activity modification of S-adenosylmethionine synthetase; an eMAT mutant with significantly improved catalytic activity is obtained by the high-throughput screening method. The specific enzyme activity of the mutant is increased from 1.82 U / mg of wild-type eMAT to 4.15 U / mg. By combined mutation with reported mutation at position 303, the obtained mutant is increased in catalytic activity in comparison to encoded eMAT in SEQ ID NO. 1, so that the time to completely convert a 1 mM substrate is 5 min earlier under the samereaction conditions.

Description

technical field [0001] The invention relates to a mutant of S-adenosylmethionine synthetase with improved catalytic activity and a high-throughput screening method thereof, belonging to the field of enzyme engineering. Background technique [0002] S-adenosylmethionine (SAM) is an important physiologically active substance that participates in more than 40 biochemical reactions such as transmethylation, transthiolation, and transaminopropylation in organisms. Clinically, SAM has significant therapeutic effects on liver diseases, depression, arthritis, etc., so the market demand is huge. [0003] At present, SAM is mainly produced by microbial fermentation, but this method has problems such as long production cycle, low substrate conversion rate, complicated extraction process, and product autosynthesis. In comparison, the enzyme-catalyzed method can overcome these problems due to its high catalytic efficiency and simple separation and purification. [0004] S-adenosylmethi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/70C12N1/21C12R1/19
CPCC12N9/1085C12N15/70C12Y205/01006
Inventor 林建平王秀朱力蒋亦琪孙志娇吴绵斌杨立荣
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap