Glucose tolerance beta-glucosidase apbgl 1a and gene and application thereof
A technology of glucose tolerance and glucosidase, applied in glucose tolerance beta-glucosidase apbgl1a and its gene and application fields
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0022] The following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only some, not all, embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by persons of ordinary skill in the art without making creative efforts belong to the protection scope of the present invention.
[0023] 1. The primers are designed as follows (the underlined part is the enzyme cutting site):
[0024] apbgl1a-EcoR I-F TCA GAATTC GTGTCCGAGACCACCACC
[0025] apbgl1a-Hind III-R TTC AAGCT The TTCAGTCGATCGGGACGATG PCR product was digested with restriction endonucleases EcoRI and HindⅢ, ligated with the same digested vector pET28a, introduced into the Escherichia coliDH5α strain for cloning, and the clones were cultured overnight at 37°C in LB containing 1...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com