Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A gene pemir393a regulating adventitious root development in poplar and its application

A root development and genetic technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of decreased sensitivity to auxin, decreased number of lateral roots in Arabidopsis roots, etc., and achieve the effect of reducing the number of lateral roots

Active Publication Date: 2022-06-28
NANJING FORESTRY UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Parry et al. (2009) found that the overexpression of miR393 can lead to a decrease in the number of lateral roots in Arabidopsis root development and a decrease in sensitivity to auxin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A gene pemir393a regulating adventitious root development in poplar and its application
  • A gene pemir393a regulating adventitious root development in poplar and its application
  • A gene pemir393a regulating adventitious root development in poplar and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Cloning of the PeMIR393a gene

[0035] Using the DNA of Populus Nanlin 895 as the material, referring to the genome sequence information of poplar (http: / / www.phytozome.net / ), the PeMIR393a gene sequence was searched, and the Oligo 7 software was used to design degenerate primers to amplify the PeMIR393a gene sequence with high fidelity. The PCR reaction system is shown in Table 1. Wherein, the degenerate primers include: forward primer: 5'CCAGGAAGC TGGTGGAGGACTCC 3'; reverse primer: 5'GAAGGCGCGAGTGGAAAATTCCA3'.

[0036] Among them, the DNA of Nanlin 895 poplar was extracted using a novel genomic DNA extraction kit (DP320) produced by Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0037] Table 1 High-fidelity PCR reaction system

[0038]

[0039] The reaction conditions were as follows: (1) pre-denaturation at 94°C for 3 min; (2) 94°C for 30s-60°C for 30s-72°C for 2min) × 38 cycles; (3) 72°C for 10 min. The amplified product was sequenced to obtai...

Embodiment 2

[0040] Example 2 Construction of p35S-pBI121-PeMIR393a vector

[0041] (1) Small amount of p2GW7.0-PeMIR393a entry vector was extracted by alkaline lysis method; 35S-pBI121-GUS expression vector was extracted in small amount by alkaline lysis method; p2GW7.0-PeMIR393a entry vector and 35S-pBI121-GUS expression vector were extracted using LRClonaseTM II Plus enzyme mix was connected, reacted at 25°C for 2h, added 0.5 μl of proteinase K, mixed gently, and then placed at 37°C for 10min reaction to extinguish the enzyme to obtain the p35S-pBI121-PeMIR393a vector. The LR cloning reaction system is shown in Table 3.

[0042] Wherein, the preparation steps of the p2GW7.0-PeMIR393a entry vector (BP clone) are as follows: the PeMIR393a obtained by PCR amplification in Example 1 is subjected to agarose gel electrophoresis, using a recovery kit (thin agarose gel DNA recovery kit, GK2043 -50. Shanghai Jierui Biological Engineering Co., Ltd.) purifying and recovering the target product; m...

Embodiment 3

[0050] Example 3 PeMIR393a gene regulates plant adventitious root development

[0051] Through the electric shock conversion method (Bio-Rad MicroPulser Bole electric transfer instrument; electric shock cup: Bio-Rad Bole electric shock cup 1652086; electric shock conditions: output range 200-3000v, precision 10v, using voltage 2.5kv, time constant 1.0ms, precision 0.1ms, Use temperature: room temperature; resistance: Rifampicin Rif) The constructed p35S-pBI121-Pe MIR393a was transformed into Agrobacterium strain LBA4404 (Invitrogen), and the Agrobacterium-mediated technology (He Guangyuan. Plant Genetic Engineering Experiment Manual [M] ]. Beijing: Tsinghua University Press, 2007) The PeMIR393a gene was transferred into Shanxin Yang. Pe-MIR393a transgenic plants were subcultured for about 6 weeks to observe the development of adventitious roots. The rooting speed of transgenic plants was significantly slower than that of non-transgenic plants, and the number of lateral roots ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses the development of a gene PeMIR393a that regulates the development of adventitious roots in poplars. The gene is derived from Populus Nanlin 895. The present invention transfers the PeMIR393a gene into Populus spp. The adventitious root results of the new poplar showed that the rooting speed was significantly slower than that of the non-transgenic plants, and the number of lateral roots was significantly reduced, which inhibited the formation of secondary lateral roots.

Description

technical field [0001] The invention relates to the field of plant genetic engineering, in particular to a gene PeMIR393a that regulates the development of poplar adventitious roots and its application. Background technique [0002] Root is an important organ for plants to absorb water and nutrients and support the above-ground parts. The growth of the root system is directly related to the growth state of the plant. The root is generally divided into embryonic root and postembryonic root. In the process of sexual reproduction of plants, it mainly promotes the growth of embryonic roots, while in the process of asexual reproduction, it promotes the growth of adventitious roots. Forest trees are more suitable for vegetative propagation because of their long growth cycle. Rooting traits play a key role in vegetative propagation and stem cutting, and are also the main reference for judging clone adaptability and stress resistance. Therefore, analyzing the formation mechanism o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/84C12N1/21A01H5/00A01H6/00C12R1/01
CPCC07K14/415C12N15/743C12N15/8261
Inventor 陈英李爽爽王浩然王光萍乐丽娜滕青云黄敏仁
Owner NANJING FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com