Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of water channel protein coded gene OsNIP3;3 of rice

An aquaporin and encoding gene technology, applied in the field of rice aquaporin encoding gene OsNIP3, can solve the problem that aquaporin genes are rarely reported and so on

Active Publication Date: 2019-07-02
NANJING AGRICULTURAL UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Aquaporin genes involved in As(III) transport in rice are rarely reported except Lsi1

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of water channel protein coded gene OsNIP3;3 of rice
  • Application of water channel protein coded gene OsNIP3;3 of rice
  • Application of water channel protein coded gene OsNIP3;3 of rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Transport activity test of aquaporin-encoding gene OsNIP3;3 in Xenopus laevis oocytes.

[0036] According to the cDNA reading frame sequences of NIP3;3, NIP2;1(Lsi1) and NIP3;1 genes, PCR primers were designed, and restriction endonuclease sites were introduced on the upstream and downstream primers respectively.

[0037]

[0038]

[0039] The amplified PCR product was detected by agarose gel electrophoresis, separated and recovered by cutting the gel. After the product was recovered, it was digested with the corresponding restriction endonuclease, and the frog egg expression vector pT7TS was digested at the same time. The digested vector was combined with The PCR fragments were ligated with T4 ligase, transformed into Escherichia coli and positive clones were extracted for enzyme digestion and DNA sequencing identification. After the correct plasmid was detected and linearized, the mMESSAGE mMACHINE (Ambion) kit was used to synthesize the single-strande...

Embodiment 2

[0041] Embodiment 2 OsNIP3; Construction of 3 overexpression vector material

[0042]1) Extraction of total RNA: Disinfect the rice seeds with 30% sodium hypochlorite solution for 30 minutes, wash 4-5 times with sterile water, then culture them with 1 / 2 MS medium for about 2 weeks, select seedlings with the same size and transfer them to the cultured After culturing in 1 / 2 Kimura nutrient solution for one week, the leaves were stored in liquid nitrogen, and RNA was extracted using a total plant RNA extraction kit (Beijing Biotec Company).

[0043] 2) The total cDNA was synthesized using a reverse transcription kit (Nanjing Nuoweizan Company).

[0044] 3) Obtaining the full length of OsNIP3;3 gene and constructing the overexpression vector:

[0045] Overexpression primers were designed according to the full-length cDNA sequence of OsNIP3;3, and the primer sequences were as follows:

[0046] OsNIP3; 3-F: AGAGGATCCCCGGGTACCATGGAAGGGCACAAGAGTGGC (seq id no. 1);

[0047] osnip3;...

Embodiment 3

[0050] Example 3 Aquaporin coding gene OsNIP3; 3 Obtaining of overexpression transgenic material

[0051] The Agrobacterium transfected with the pTCK303-OsNIP3;3 plasmid obtained in Example 2 was used to infect the Nipponbare rice callus, and after co-cultivation for 2 days, transgenic plants of the T0 generation were obtained through selection, differentiation, rooting, and seedling hardening.

[0052] Reagents and Solutions Abbreviations

[0053] Among the present invention, the used English abbreviation of culture medium is expressed as follows: 6-BA (6-benzyl adenine); Car (carbenicillin); NAA (naphthalene acetic acid); IAA (indole acetic acid); -D (2,4-dichlorophenoxyacetic acid); AS (acetosyringone); CH (hydrolyzed casein); L-pro (L-proline); L-Glu (L-glutamine); MES (2-morpholineethanesulfonic acid); N6 (N6 macroelement solution); B5 (B5 trace element solution); AA (AA macroelement); Agar (agar).

[0054] Solutions and Media Formulations

[0055] Ⅰ hormone preparatio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of a water channel protein coded gene OsNIP3;3 of rice. The registered number of the water channel protein coded gene OsNIP3;3 in Genbank is AB710141. The gene can be applied to reducing the concentration of trivalent As of rice stele parts, reducing loading of the trivalent As to xylem and notably reducing arsenic accumulation of overground parts and grainsof the rice. Through massive experiment, the inventor finds the biological function of the water channel protein coded gene OsNIP3;3 in the rice, and after the gene is subjected to overexpression, theAs content of the overground parts of the rice is reduced. After the gene is subjected to overexpression, the accumulation of As in leaves, seed shells and grains of the rice can be notably reduced.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and relates to the application of rice aquaporin coding gene OsNIP3;3. Background technique [0002] At present, the problem of heavy metal pollution in the environment is becoming more and more prominent, and the pollution of arsenic (As) in cultivated land is also becoming more and more serious. Rice is an important food crop, and about half of the world's population uses rice as the main food crop. Due to the enrichment of arsenic in rice, rice accounts for 60% of the dietary arsenic intake of the Chinese population (Li et al. 2009). Therefore, it is very important to analyze the mechanism of rice's absorption and detoxification of As and to develop methods to reduce the accumulation of As in rice grains through genetic engineering technology. In soil, arsenic exists in the form of pentavalent arsenic As(V) and trivalent arsenic As(III) under aerobic conditions and flooded conditi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N15/66
CPCC07K14/415C12N15/8271
Inventor 赵方杰孙晟凯唐仲黄新元马建锋
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com