Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Applications of tobacco MLO2, MLO6 and MLO12 genes in preparation of tobacco varieties resistant to powdery mildew, and method for preparing tobacco varieties resistant to powdery mildew

A powdery mildew and anti-powdery mildew technology, applied in the biological field, can solve problems such as lack of research data

Active Publication Date: 2019-05-07
SOUTHWEST UNIVERSITY
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The MLO gene family also exists in tobacco, but there are a large number of tobacco MLO homologous genes, and there is no relevant research data on which genes are related to the resistance to powdery mildew
Therefore, there is no report on the precise targeted inactivation of the tobacco MLO gene to obtain powdery mildew resistant tobacco breeding materials

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Applications of tobacco MLO2, MLO6 and MLO12 genes in preparation of tobacco varieties resistant to powdery mildew, and method for preparing tobacco varieties resistant to powdery mildew
  • Applications of tobacco MLO2, MLO6 and MLO12 genes in preparation of tobacco varieties resistant to powdery mildew, and method for preparing tobacco varieties resistant to powdery mildew
  • Applications of tobacco MLO2, MLO6 and MLO12 genes in preparation of tobacco varieties resistant to powdery mildew, and method for preparing tobacco varieties resistant to powdery mildew

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1, the acquisition of tobacco MLO2, MLO6, MLO12 gene fragment

[0027] The genomic DNA of the tobacco variety Honghua Dajinyuan was used as a template to design primers for cloning tobacco MLO2, MLO6 and MLO12 genes. The specific primers are as follows:

[0028] NtMLO2-fragment-F: 5'-cactgattgacgaaccttattg-3' (SEQ ID NO.1);

[0029] NtMLO6-fragment-F: 5'-tgaagagctttgctacttggat-3' (SEQ ID NO.2);

[0030] NtMLO12-fragment-F: 5'-atggaggcaactccgact-3' (SEQ ID NO.3);

[0031] NtMLO2-fragment-R: 5'-gtcagcgcatttgtcagttc-3' (SEQ ID NO. 4);

[0032] NtMLO6-fragment-R: 5'-gccaatgtggtaatacagtagaat-3' (SEQ ID NO. 5);

[0033]NtMLO12-fragment-R: 5'-ctttggcacgcataagttag-3' (SEQ ID NO. 6);

[0034] Then PCR amplification was carried out with the designed primers. The PCR amplification conditions were: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 40 s, annealing at 56°C for 40 s, extension at 72°C for 45 s, and 30 cycles; extension at 72°C for 10 min, and...

Embodiment 2

[0042] Example 2, MLO2, MLO6 and MLO12 three gene editing target sequence information and gene editing inactivation vector construction

[0043] Select "tatccctactgttaacagta" (SEQ ID NO.10) in the amplified MLO2 gene fragment sequence (SEQ ID NO.7), select "caacgtggctaaagaggctg" in the amplified MLO6 gene fragment sequence (SEQ ID NO.8) ( "cgcagtttgcttcatcttgc" (SEQ ID NO.12) was selected as the target site to be edited in SEQ ID NO.11) and the amplified MLO12 gene fragment sequence (SEQ ID NO.9). Refer to the published method of tRNA-mediated multiple gene editing (Kabin X, Bastian M, Yinong Y(2015). "Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA-processing system."Proc Natl Acad Sci U S A 112: 3570-3575), synthesize the polycistronic tRNA-gRNA of MLO2, MLO6 and MLO12 genes, the specific sequences are as SEQ ID NO.13 and figure 1 shown. The polycistronic tRNA-gRNA and pORE-Cas9 vectors of MLO2, MLO6 and MLO12 were digested with Bsa I (Gao, J., G...

Embodiment 3

[0055] Embodiment 3, engineering bacterium preparation and transgenic tobacco preparation

[0056] Knockout vector transformation Agrobacterium preparation, the specific steps are as follows:

[0057] 1) Take ≦1 μg of pORE-Cas9-MLO2MLO6MLO12editing recombinant plasmid with correct sequencing and add it to 100 μL of Agrobacterium competent cells (add when the competent cells are just dissolved), flick and mix well, and ice-bath for 30 minutes;

[0058] 2) Immediately heat-shock in a 37°C water bath for 5 minutes after quick-freezing in liquid nitrogen for 1 minute;

[0059] 3) Add 1 mL of YEB liquid medium, and incubate at 28° C. and 220 rpm for 4-6 hours (flocculents appear).

[0060]4) Centrifuge at 4000rpm for 3 minutes, discard the supernatant, add 200 μL of fresh YEB medium, blow and mix with a pipette tip, and spread evenly on the YEB solid plate (final concentration of Rif is 50 mg / L, final concentration of Str is 50 mg / L, final concentration of Kan Concentration 50mg / ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses applications of tobacco Mildew resistance locus O (MLO) genes MLO2, MLO6 and MLO12 in the preparation of tobacco varieties resistant to powdery mildew, and a method for preparing the tobacco varieties resistant to powdery mildew. Through the construction of an editing inactive carrier containing polycistron tRNA-gRNA editing MLO2, MLO6 and MLO12 genes, tobacco can show obvious resistance on powdery mildew after the MLO2, MLO6 and MLO12 genes are inactivated by editing; and research results have important application values on researching the anti-disease immune mechanisms of plant on fungi and cultivating the tobacco varieties resistant to the powdery mildew.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of tobacco MLO2, MLO6 and MLO12 genes in the preparation of tobacco varieties resistant to powdery mildew, and also to a method for preparing tobacco varieties resistant to powdery mildew. Background technique [0002] Powdery mildew can infect more than 650 species of monocotyledonous plants and more than 9,000 species of dicotyledonous plants. Huge losses have seriously affected agricultural production. At present, powdery mildew occurs in various places in my country, and the damage of powdery mildew presents the characteristics of large outbreak range and wide infectivity. my country is the largest tobacco producing country in the world today, and the total output and sales of tobacco leaves account for about 30% of the world. At present, tobacco taxation has accounted for 1 / 10 of our country's fiscal revenue, and tobacco has become an important economic plant i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/29C12N15/82A01H5/00A01H6/82
Inventor 王根洪夏庆友吴磊赵萍罗培
Owner SOUTHWEST UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More