Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

MicroRNA for inhibiting expression of Sirt1 of chicken as well as recombinant over-expression plasmid and LMH cell line of microRNA

A gene expression and cell line technology, applied in the field of cell engineering, can solve the problems of feed utilization and egg production rate decline, affecting animal health, etc.

Active Publication Date: 2019-01-08
CHANGSHU INSTITUTE OF TECHNOLOGY
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In poultry production, excessive fat deposition not only affects the health of animals, but also causes problems such as feed utilization and egg production rate reduction

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • MicroRNA for inhibiting expression of Sirt1 of chicken as well as recombinant over-expression plasmid and LMH cell line of microRNA
  • MicroRNA for inhibiting expression of Sirt1 of chicken as well as recombinant over-expression plasmid and LMH cell line of microRNA
  • MicroRNA for inhibiting expression of Sirt1 of chicken as well as recombinant over-expression plasmid and LMH cell line of microRNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1 suppresses the design of the microRNAs of chicken Sirt1 gene expression

[0029] The 3'UTR sequence of the chicken Sirt1 gene obtained by cloning was imported into Designed microRNA (the BLOCK-iT TM RNAi Designer) online analysis tool (http: / / rnaidesigner.thermofisher.com / rnaiexpress / setOption.do?designOption=mirna&pid=-3453238029932242172), select the target site region as "3'UTR"; select species as chicken, GC content The choice is 35%-55%. The three miR RNAi with the best scores at three different sites were selected, respectively: gSmiR30: "5'AUGCCAAAGCUUCUAAUGCUG3'"; gSmiR70: "UUUCCUUGCUCUAAAUCCAGA" and gSmiR91: "AUAAACACCACAUCCUUAUGG".

Embodiment 2

[0030] The construction of embodiment 2miRNAs overexpression vector

[0031] Using the base sequence and pcDNA of the pLNHX plasmid TM The microRNA expression framework sequence on the 6.2-GW / EmGFP-miR plasmid will be pcDNA TM The sequence between 17-1919 on the 6.2-GW plasmid (including CMV promoter, attB1 site, EmGFP gene sequence, 5' and 3' miR flanking sequences, attB2 site and TK polyadenylation signal) replaced pLNHX The fragment of the 2047-2370 region on the plasmid (including the HSP70 promoter and the multiple cloning site) was successfully constructed into the pLNCX-pmiRG plasmid, and its sequence is shown in SEQ ID NO:11.

[0032] Design primers according to the designed microRNA, add and insert the microRNA precursor DNA sequence designed in Example 1 into the microRNA expression frame of pLNCX-pmirG by PCR amplification method, and obtain the plasmids of recombined microRNA: pLNCX-gSmiR30, pLNCX-gSmiR70 , pLNCX-gSmiR91.

[0033] Methods as below:

[0034] Use...

Embodiment 3

[0050] Embodiment 3 miRNAs effect test

[0051] 1. According to the chicken Sirt1 gene 3'UTR sequence cloned in our laboratory, use ggaSIRT1-UTR672-F (ATCTCGAGAGTGCTCACTGGTTACAGG) / ggaSIRT1-UTR672-R (ATGCGGCCGCAAGCTCAGTAACTGAAGC) to obtain the gene containing 3 miRNAs (gSmiR30, 70 and 91) act on the 3′UTR sequence of the Sirt1 gene at the target site, and clone it into the 3′UTR region of the Synthetic Renilla luciferase gene (hRluc) gene in pSicheck2 to obtain the dual luciferase reporter vector pSicheck2- gSirt1-UTR672. Proceed as follows:

[0052] (1) The genome of chicken red blood cells was extracted by phenol imitation method;

[0053] (2) PCR amplification of the target fragment (gSirt1-UTR672):

[0054] reaction system:

[0055]

[0056] Reaction conditions:

[0057]

[0058] (3) After 1% agarose gel electrophoresis, the target fragment was recovered, and the recovered fragment and the reporter vector pSicheck2 plasmid were digested with Xho I and Not I, resp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a microRNA for inhiting expression of Sirt1 of chicken, and also discloses a recombinant over-expression plasmid and specific application of the microRNA, and an LMH cell linefor constructing stable low-expression Sirt1 by utilizing over-expression miRNAs. Compared with the prior art, a target gene is interfered by artificially designed miRNA, and an over-expression vectorof the miRNA is directly and quickly constructed according to a simple PCR technology; pLNCX-pmirG provided by the invention is a very good vector for performing over-expression on the miRNA, retroviruses can be packaged in sequence, the cell line of stable over-expression miRNA can be quickly obtained by combining G418 pressurized screening and green fluorescent protein detecting methods; a reply mechanism of the Sirt1 that affecting the liver to a nutrition state can be disclosed by the research, and a unique hepatocyte subcloning system model is also provided for researching the functionsof human and animal livers in energy metabolism.

Description

technical field [0001] The invention relates to cell engineering, in particular to a microRNA for inhibiting the expression of chicken Sirt1 gene, its recombinant overexpression plasmid and LMH cell line. Background technique [0002] SIRT1 acts as a NAD-dependent + Sirtuin, the cellular metabolic state (energy state) factor NAD + Make SIRT1 an important molecule linking energy metabolism and gene transcription, SIRT1 through NAD + Network regulation linking metabolic levels and gene transcription in the nucleus, and the body's response to nutrients, hormones, and environmental stimuli. The liver is an important site for animal nutrition and energy metabolism, responsible for glycogen synthesis, gluconeogenesis, fatty acid and cholesterol synthesis, lipoprotein production and secretion, etc. Material and energy balance, especially in glucose and lipid metabolism, play an important role. When the body takes in excess energy substances, the liver can convert these excess e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/867C12N15/66C12N5/10A61K31/7105A61P1/16A61P3/04
CPCA61K31/7105A61P1/16A61P3/04C12N9/78C12N15/1137C12N15/66C12N15/86C12N2310/141C12N2740/10043
Inventor 郁建锋顾志良王中亮陈迟迟张燕萍邵芳徐璐胡悦
Owner CHANGSHU INSTITUTE OF TECHNOLOGY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com