Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

CD19-CAR-T (Chimeric Antigen Receptor T) cell interfering with IL (interleukin)-6 expression and application thereof

A technology of IL-6 and il-6shrna-2, which is applied in the field of genetic engineering and cell biology, can solve the problems of patient death, interference with target gene expression, and short timeliness of interference, etc.

Active Publication Date: 2018-11-06
山东省齐鲁细胞治疗工程技术有限公司
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In early July 2016, Seattle-based JunoTherapeutics reported that in the company's clinical trial JCAR015, three patients (later confirmed to be four) died after receiving CAR-T cell therapy, and the FDA immediately stopped In the clinical trial of JCAR015, Juno later explained that the use of the chemotherapy drug fludarabine caused neurotoxins, but many people speculated that it was due to the strong cytokine storm (CRS) generated by the input T cells that caused the death of the patient
The earliest method of using RNAi technology to study gene function in organisms is to directly inject single-stranded siRNA molecules prepared in vitro into nematodes. Although it was later used in gene function research, this method has relatively short interference timeliness. Increased concentration of siRNA for effective interference is often cytotoxic
The current RNAi technology mostly adopts the method of constructing a specific RNAi expression vector. After the vector is introduced into animal and plant cells, the corresponding shRNA, amiRNA, etc. can be transcribed by the RNA polymerase type II or III promoter, and then interfere with the target gene. expression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CD19-CAR-T (Chimeric Antigen Receptor T) cell interfering with IL (interleukin)-6 expression and application thereof
  • CD19-CAR-T (Chimeric Antigen Receptor T) cell interfering with IL (interleukin)-6 expression and application thereof
  • CD19-CAR-T (Chimeric Antigen Receptor T) cell interfering with IL (interleukin)-6 expression and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0094] Example 1: Synthesis of IL-6 shRNA capable of being cloned into a vector

[0095] Check the sequence of IL-6 shRNA on the official website of Sigma-Aldrich China, and select three of them (6-1, 6-2, 6-3), and their nucleotide sequences are shown below.

[0096] 6-1: CCGG CTGGATTCAATGAGGAGACTT CTCGAGAAGTCTCCTCATTGAATCCAGTTTTTG.

[0097] 6-2: CCGG CAGAACGAATTGACAAACAAA CTCGAGTTTGTTTGTCAATTCGTTCTGTTTTTG.

[0098] 6-3: CCGG ATGAGCGTTAGGACACTATTT CTCGAGAAATAGTGTCCTAACGCTCATTTTTTG.

[0099] Wherein, the underlined sequence is the sequence of siRNA in each.

[0100] The present invention adopts the traditional method of cloning into vector, and inserts two DNA oligonucleotides encoding IL-6 siRNA sequence into the vector. The DNA oligonucleotide is a positive-sense siRNA sequence containing 21 nucleotides long, and the 9-nucleotide spacer sequence TTCAAGAGA successfully used by Ambion scientists is connected to its reverse complementary antisense siRNA sequence. 5 Ts...

Embodiment 2

[0111] Example 2: Construction of dual expression vectors for IL-6shRNA and CD19CAR

[0112] Such as figure 1 As shown, the CD8 transmembrane signal peptide, myc tag, anti-CD19Scfv, CD8 transmembrane region, 4-1BB co-stimulatory signal region and CD3Zeta TCR activation region, U6 promoter, IL-6 shRNA were cloned sequentially into the lentiviral backbone plasmid In pHR, the pHR-antiCD19CAR-U6-IL-6shRNA plasmid was obtained (there are three kinds of IL-6shRNA involved in the experiment, so there are also three kinds of plasmids obtained, respectively as follows).

[0113] The nucleotide sequence of CD8amyc-anti-CD19Scfv-CD8TM-4-1BB-CD3Zeta-U6-IL-6shRNA-1 is shown below (shown as SEQ ID NO: 13).

[0114] Shown in SEQ ID NO:13:

[0115]ATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCTCCACGCCGCCAGGCCGGAGCAGAAGCTGATCAGCGAGGAGGACCTGACTAGTGACATCCAGATGACACAGACTACATCCTCCCTGTCTGCCTCTCTGGGAGACAGAGTCACCATCAGTTGCAGGGCAAGTCAGGACATTAGTAAATATTTAAATTGGTATCAGCAGAAACCAGATGGAACTGTTAAACTCCTGATCTACC...

Embodiment 3

[0121] Embodiment 3: Preparation of pHR-IL-6-GFP screening plasmid

[0122] Such as figure 2 As shown, IL-6 and GFP were sequentially cloned into the lentiviral backbone plasmid pHR to obtain the pHR-IL-6-GFP plasmid. GFP in the pHR-IL-6-GFP is a reporter gene, which is used to detect the gene silencing efficiency of IL-6.

[0123] The nucleotide sequence of the IL-6-GFP fusion protein is as follows:

[0124] ATGAACTCCTTCTCCACAAGCGCCTTCGGTCCAGTTGCCTTCTCCCTGGGGCTGCTCCTGGTGTTGCCTGCTGCCTTCCCTGCCCCAGTACCCCCAGGAGAAGATTCCAAAGATGTAGCCGCCCCACACAGACAGCCACTCACCTCTTCAGAACGAATTGACAAACAAATTCGGTACATCCTCGACGGCATCTCAGCCCTGAGAAAGGAGACATGTAACAAGAGTAACATGTGTGAAAGCAGCAAAGAGGCACTGGCAGAAAACAACCTGAACCTTCCAAAGATGGCTGAAAAAGATGGATGCTTCCAATCTGGATTCAATGAGGAGACTTGCCTGGTGAAAATCATCACTGGTCTTTTGGAGTTTGAGGTATACCTAGAGTACCTCCAGAACAGATTTGAGAGTAGTGAGGAACAAGCCAGAGCTGTGCAGATGAGTACAAAAGTCCTGATCCAGTTCCTGCAGAAAAAGGCAAAGAATCTAGATGCAATAACCACCCCTGACCCAACCACAAATGCCAGCCTGCTGACGAAGCTGCAGGCACAGAACCAGTGGCTGCAGGACATGACAACTCAT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses two shRNAs (short hairpin RNA) interfering with human IL (interleukin)-6 gene expression shown as SEQ ID NO: 1 and SEQ ID NO: 2. The invention further discloses a lentiviral expression vector. The lentiviral expression vector contains the shRNAs interfering with the human IL-6 gene expression and a chimeric antigen receptor encoding nucleotide fragment shown as SEQ ID NO: 4. The invention further discloses a CD19-CAR-T cell interfering with the human IL-6 gene expression. The CD19-CAR-T cell is a T lymphocyte containing the lentiviral expression vector, or a T lymphocyte which is integrated with the shRNAs interfering with the human IL-6 gene expression and the chimeric antigen receptor encoding nucleotide fragment in a chromosome. The IL-6 shRNAs are introduced into the CAR-T cell, the shRNAs of IL-6 are coexpressed while CAR is expressed, and release of the IL-6 is inhibited from the source by a gene silencing technology, so that influence of CRS (cytokine release syndrome) is reduced and the safety of CAR-T treatment is improved. Important application to preparation of medicines for prevention, treatment and adjuvant treatment of malignant tumors can be expected.

Description

technical field [0001] The invention relates to the preparation and application of chimeric antigen receptor T cells (Chimeric AntigenReceptor T cells, CAR-T) targeting CD19 that interfere with the expression of IL-6 and belong to the fields of genetic engineering and cell biology. Background technique [0002] In 1989, the concept of chimeric antigen receptor-modified T cells (CAR-T) was first proposed to establish adoptive cell therapy with tumor-specific recognition capabilities. The design of the first-generation CAR is to simply replace the extracellular region of the TCR (T cell receptor) with scFv (single-chain antibody variable region fragment) fragments derived from specific monoclonal antibodies, retaining the transmembrane structure and intracellular signal transmission In the CD3ζ region, some research groups also use FcR for the intracellular signal transmission part. However, the results of the first-generation CAR clinical trials were very disappointing. In t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N5/10C12N15/11C12N7/01C12N15/867A61K35/17A61P35/00A61P35/02
CPCA61K35/17A61P35/00A61P35/02C07K14/5412C12N5/0636C12N7/00C12N15/1136C12N15/86C12N2310/122C12N2510/00C12N2740/15043
Inventor 谭毅郭红张慧慧
Owner 山东省齐鲁细胞治疗工程技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products