Ochrobactrum-mediated transformation of plants

A technology of Bacillus pallidus and the genus Pallidum, which is applied in the field of plant biology and can solve problems such as low transformation efficiency

Inactive Publication Date: 2018-09-07
PIONEER HI BRED INT INC +1
View PDF406 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Other bacterial strains generally have significantly lower transformation effic

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ochrobactrum-mediated transformation of plants
  • Ochrobactrum-mediated transformation of plants
  • Ochrobactrum-mediated transformation of plants

Examples

Experimental program
Comparison scheme
Effect test

example

[0121] Those skilled in the art will recognize the many advantages of the methods and compositions provided herein. The following examples provide detailed specific studies, methods, and compositions, however, those skilled in the art will appreciate that many changes can be made in the specific examples disclosed and still obtain like or similar results without departing from the disclosure spirit and scope. All references cited herein are incorporated by reference in their entirety, including whether they supplement, explain, provide a background, or teach the methodology, technique, or composition employed herein.

[0122] Example 1 - Plasmid construction

[0123] Plasmid pVir8 (PHP70365; SEQ ID NO: 106) is a 38.8 kb vector with the vir gene and T-DNA, constructed in E. coli using standard molecular biology methods. It has two origins (ColE1, pVS1) to replicate stably in a wide range of bacteria and encodes resistance to the antibiotic gentamicin. It contains ~27 kb of...

example 2

[0136] Example 2 - Bacterial screening using transient DsRED expression in tobacco BY-2 suspension cultures

[0137] Tobacco BY-2 cells were provided by RIKEN BRC [RIKEN Bio-Resource Center] through the National Bio-Resource Project of the Ministry of Education, Culture, Sports, Science and Technology (MEXT). Nagata et al. (IntRev Cytol [International Review of Cytology] (1992) 132: 1-30) primarily describe methods for maintaining tobacco BY-2 suspension cultures and an improved method using BY-2 suspension cells (Newman et al. (1993 ) Plant Cell [Plant Cell] 5:701-714) for transient expression of DsRED.

[0138] From the gentamicin-resistant strains transformed with PHP70365, 24 bacterial strains showed different levels of DsRED expression in BY-2 cells as observed under a Leica fluorescence stereomicroscope.

example 3-D

[0139] Example 3-DNA extraction and PCR of 16S rDNA

[0140] Various assays were performed to identify the Pallidum species used for plant transformation. First, use MasterPure TM Genomic DNA was prepared with a DNA purification kit (Cat#MCD85201, Epibio, Madison, WI, USA). Using genomic DNA extracted from 24 bacteria, PCR was performed with a PTC-100TM programmable thermal controller (MJ Research, Inc., San Francisco, CA, USA). Primers used for amplification were:

[0141] SEQ ID NO: 102 16S-F 5'AGAGTTTGATCCTGGCTCAG 3'

[0142] SEQ ID NO: 103 16S-R 5'ACGGCTACCTTGTTACGACTT 3'

[0143] The PCR mix consists of 5 μL (100-200ng) of bacterial DNA, 1.25 μL of 50 mM MgCl 2 , 0.25 μL of Taq DNA polymerase (5 U / μL, GIBCO BRL, Cleveland), 2.5 μL of 10x Taq buffer (GIBCO BRL), 0.5 μL of 10 mM dNTP, 10 μM primers, and 15 μL of sterile distilled water. The sample was heated to 94°C for 1 minute, followed by 30 cycles of 94°C (30 seconds), 50°C (30 seconds), 72°C (90 seconds), then ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

Methods and compositions for Ochrobactrum-mediated transformation of plants are provided. Methods include but are not limited to using an Ochrobactrum strain to transfer a polynucleotide of interest to a plant cell. These include VirD2-dependent methods. Compositions include an Ochrobactrum strain, transfer DNAs, constructs and/or plasmids. These include Ochrobactrum strains having a plasmid comprising one or more virulence gene(s), border region, and/or origin of replication. Plant cells, tissues, plants, and seeds comprising a polynucleotide of interest produced by the methods are also provided.

Description

technical field [0001] The present disclosure relates to the field of plant biotechnology. In particular, the present disclosure relates to methods for producing transgenic plants and plant cells using bacteria-mediated delivery. [0002] Cross References to Related Applications [0003] This application claims priority to US Provisional Application No. 62 / 211267, filed August 28, 2015, which is hereby incorporated by reference in its entirety. [0004] References to Sequence Listings Submitted as Text Files via EFS-WEB [0005] The official copy of this Sequence Listing is submitted electronically via EFS-Web as a Sequence Listing in ASCII format under the file name "20160826_6502WOPCT_SeqList.txt", created on August 24, 2016, and has a size of 861KB and is submitted simultaneously with this specification . The Sequence Listing included in this file in ASCII format is part of this specification and is hereby incorporated by reference in its entirety. Background techniqu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/82C07K14/195
CPCC07K14/195C12N15/8202C12N15/8205C12N15/65C12N15/8243
Inventor A.阿南德S.H.巴斯S.M.伯泰恩H-J.乔A.J.金尼T.M.克莱恩M.拉斯纳K.E.麦布里德Y.莫伊B.A.M.罗森卫俊智
Owner PIONEER HI BRED INT INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap