A kit and method for detecting her-2 gene copy number variation based on digital PCR technology
A HER-2, gene copy number technology, applied in the field of biomedical nucleic acid detection, can solve the problem of low accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1: Design of specific PCR primers and detection probe sequences for detecting copy number variation of HER-2 gene
[0032] 1. Sequence acquisition: the HER-2, CEP17, EFTUD2, EIF2C1 gene detection sites involved in the present invention are shown in Table 1.
[0033] Table 1, HER-2, CEP17, EFTUD2, EIF2C1 gene detection sites
[0034] gene Gene locus region HER-217q12 CEP1717p11.2 EFTUD217q21.31 EIF2C11p34.3
[0035] 2. Design method: According to the HER-2, CEP17, EIF2C1, EFTUD2 gene sequences published by the NCBI database, design specific primers and detection probes (Table 2).
[0036] Table 2. Sequence list of HER-2, CEP17, EIF2C1, EFTUD2 primers and detection probes
[0037] Gene locus Primer and probe name serial number Sequence (5’-3’) HER-2-1F Forward primer 1 SEQ ID No. 1 GGTAGAACCTTTGCTGTC HER-2-1R Reverse primer 1 SEQ ID No. 2 GCAGAACCATACTGATGA HER-2-1P Detection probe 1 SEQ ID No. 3 TGTTCACCACTCTACCTCCAGC HER-2-2F Forward primer 2 SEQ ID No. 4...
Embodiment 2
[0039] Embodiment 2: A kit and method for detecting HER-2 gene copy number variation based on digital PCR technology is used to detect the HER-2 gene copy number variation in a paraffin tissue section sample.
[0040] 1. Materials: Paraffin section samples of 18 breast cancer patients who have been tested and identified by IHC or FISH.
[0041] 2. Method: Use Naica Crystal Digital TM Digital PCR instrument (STILLA Technologies, France) for digital PCR detection.
[0042] (1) Nucleic acid extraction: It is recommended to use the paraffin section DNA extraction kit (QIAGEN company, CatNo.56404, USA) for DNA extraction. The extraction step is carried out in accordance with the product instructions. 50μL of DNA solution is collected and tested directly or stored at -20°C. At the same time, the negative and positive quality control products are tested.
[0043] (2) Prepare the digital PCR reaction solution according to Table 3. After the preparation is completed, the PCR reaction tube i...
Embodiment 3
[0063] Embodiment 3: A kit and method for detecting HER-2 gene copy number variation based on digital PCR technology is used to detect HER-2 gene copy number variation in blood samples.
[0064] 1. Materials: randomly selected blood samples from 5 of the 18 breast cancer patients in Example 2
[0065] 2. Method: Use Naica Crystal Digital TM Digital PCR machine (STILLA Technologies, France) for testing.
[0066] (1) Sample collection: Use venipuncture for blood samples, and collect 10 mL of blood samples with STRECK BCT tube or EDTA anticoagulation tube (purple); if plasma separation cannot be performed within 2 hours, cell-free DNA protection is required when whole blood is collected The special room temperature blood collection tube (such as Streck BCT tube) for anti-cell lysis protective agent.
[0067] (2) Storage and transportation of blood samples: STRECK BCT tubes are blood collection tubes used for transportation and short-term storage within the specified temperature range (...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com