Supercharge Your Innovation With Domain-Expert AI Agents!

Application of phage Vp670 perforin gene holA

A perforin and gene technology, applied in phage, virus/phage, applications, etc., can solve problems such as mutation of the action site, achieve the effect of reducing workload and improving screening efficiency

Inactive Publication Date: 2018-08-17
SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in actual operation, we found that a considerable number of bacterial sacB gene expression metabolites are not sensitive to lethality, resulting in a large number of false positives in the screening; the toxicity of ccdB expression products has a broad spectrum, but bacteria are prone to ccdB expression products. site of action mutation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of phage Vp670 perforin gene holA
  • Application of phage Vp670 perforin gene holA
  • Application of phage Vp670 perforin gene holA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Bioinformatics analysis of holA and cwlQ

[0026] The phage Vp670 genome was sequenced by the inventor and published in GenBank (KY290756.1). The genome sequence of Vp670 was annotated by RAST ( http: / / rast.nmpdr.org / ), the analysis found that orf3 encodes a hypothetical protein, searched by Blastp ( https: / / blast.ncbi.nlm.nih.gov / Blast.cgi ) found that the orf3 encoded product has only 49% identity with the amino acid sequence of the closest phage perforin, but the orf3 encoded product has a conserved domain of phage perforin, orf3 is named holA, and its sequence is as shown in the sequence table SEQ ID As shown in No. 1 (specifically: GTGAGTGAAAAGATTGTAAAAGCAGTAGAGGTAGTCCGTGAGACTCTACCAGCAGCGCCACCTGCGGCGTATGTTGGTATGAAGTTCTACGGCATCTCTTTGCCAGATATAGTATCTATAGCTACTCTGATATACTTAGTTATACAGATTGGCTACATTCTTTATAAGTGGAGAAAGGGGATTTAA), the expression product is named as HolA, and its amino acid sequence is shown in No. 2 of the sequence table.

[0027] Using TMHMM ( ...

Embodiment 2

[0029] Embodiment 2: construct the expression plasmid of perforin gene (holA) and endolysin gene (cwlQ)

[0030] In order to explore the functions of perforin HolA and endolysin CwlQ and the synergistic relationship between them, the plasmid pBAD18-kan was used to construct the fragments containing only cwlQ (the nucleotide sequence of which is shown in SEQ ID No.3), containing only The holA fragment (its nucleotide sequence is shown in SEQ ID No.1) and the recombinant plasmid containing the fusion fragment of endolysin cwlQ and holA two genes.

[0031] Primers used for PCR amplification of cwlQ gene:

[0032] Endolysin-F: GCGAATTCGAGCTCGGTACCAGGAGGAATTCACCATGTTCGTTGAAGCAATTCT

[0033] Endolysin-R: CCAAGCTTGCATGCCTGCAGTCAAGGTCTTCCTCCATTATC

[0034] Primers used for PCR amplification of holA gene:

[0035] holin-F: TTACAATCTTTTCACTCACGTTCAAGGTCTTCCTCCATTATC

[0036] holin-R: GATAATGGAGGAAGACCTTGAACGTGAGTGAAAAGATTGTAA

[0037] To construct a recombinant plasmid containing t...

Embodiment 3

[0045] Embodiment 3: Construction of Vibrio alginolyticus controllable expression bacteria of perforin gene (holA) and endolysin gene (cwlQ)

[0046] Vibrio alginolyticus E06333 was cultured in brain heart infusion medium (BHI) overnight at 30°C. The above four plasmids (pBAD18-kan, pBAD18-holA, pBAD18-cwlQ, pBAD18-holA-cwlQ) were respectively electrotransformed into Vibrio alginolyticus E06333, and the method of electrotransformation was included in the inventor's published patent (CN104195073A). Electric shock voltage 1.8kV, electric shock time 1ms. After the electric shock, the cell suspension was quickly added to the BHI medium (BD) containing 0.3% D-Glu, and the culture was resumed at 30°C for 1 hour. After the culture solution was diluted 10 times and 100 times, 100 μl was respectively applied to LB plates containing Kan resistance. , after culturing overnight at 30°C, colonies were picked and cultured in liquid BHI containing kanamycin (Kan) resistance for 12 hours. S...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of a phage Vp670 perforin gene holA. A gene sequence of the holA is as shown in SEQ ID No.1, an encoded amino acid sequence of the holA is as shown in SEQ ID No.2, a gene sequence of cwlQ is as shown in SEQ ID No.3, and an encoded amino acid sequence of the cwlQ is as shown in SEQ ID No.4. According to the application, the holA serving as the perforin gene isfirstly authenticated in the phage Vp670, and the cwlQ is an endolysin gene. According to the application, the HolA is separately expressed in a bacterium and sufficiently kills bacterium cells, a host bacterium does not easily generate tolerance, the HolA can be used for cloning vectors or suicide plasmids, the screening efficiency of positive recombinants can be greatly improved, and laboratoryworkloads are decreased. HolA and CwlQ proteins are collectively expressed in a phage, an expression product can completely lyse the bacterium, a lot of loss of phage contents is forced, and an effective technological mean is provided for mild lysis of microorganisms such as the bacterium and extraction of cell contents.

Description

Technical field: [0001] The invention belongs to the field of biogenetic engineering, in particular to the application of a perforin gene (holA) and an endolysin gene (cwlQ) of Vibrio alginolyticus phage Vp670. Background technique: [0002] Vibrio alginolyticus, as a Gram-negative bacterium, is an opportunistic pathogen for marine organisms and humans. Epidemic diseases caused by outbreaks of Vibrio alginolyticus have been reported to cause huge economic losses to the aquaculture industry. Generally, Vibrio alginolyticus and other pathogenic Vibrio are controlled by antibiotics, and the use of antibiotics has brought a series of environmental and ecological problems. With the emergence of super drug-resistant bacteria, the use of phages for biological control of pathogenic bacteria has become a research hotspot again in recent years. In addition, the development and utilization of genetic resources of phages has been ongoing. [0003] In biotechnology experiments, sonicat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/34C12N15/63C07K14/01
CPCC07K14/005C12N15/63C12N2795/00022C12N2795/00032
Inventor 罗鹏田雨顺刘秋婷云龙胡超群
Owner SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More