Supercharge Your Innovation With Domain-Expert AI Agents!

RPA kit for detecting cyprinid herpesvirus 2, CyHV-II in real time at constant temperature, and primer and probe special for RPA kit

A carp herpes virus, real-time detection technology, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve problems such as unfavorable sequencing construction, cumbersome primer design, and long time-consuming PCR technology

Inactive Publication Date: 2018-05-25
SHANGHAI OCEAN UNIV
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Among the conventional CyHV-II detection technologies, the LAMP technology has a complex reaction principle and cumbersome primer design, and the conservative segment required for the target sequence is relatively strict when designing primers, and the reaction products are not uniform, which is not conducive to the later sequencing and construction of clones, so there is no Widely used; PCR technology takes a long time, costs high, and requires precise temperature cycle instruments, which severely limits the application of PCR technology in on-site detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RPA kit for detecting cyprinid herpesvirus 2, CyHV-II in real time at constant temperature, and primer and probe special for RPA kit
  • RPA kit for detecting cyprinid herpesvirus 2, CyHV-II in real time at constant temperature, and primer and probe special for RPA kit
  • RPA kit for detecting cyprinid herpesvirus 2, CyHV-II in real time at constant temperature, and primer and probe special for RPA kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Design and screening of RPA-specific primers and probes for constant temperature real-time detection of type II carp herpes virus

[0026] The present embodiment entrusts Shanghai Bioengineering Company to design specific primer sequences and probe sequences for the CyHV-II target gene, wherein:

[0027] The forward primer sequence is CCCAGGAGACCAGCAGACTGTTGAACCCGTAC;

[0028] The reverse primer sequence was GTATCCGCCTCGTCCATCATAGAGCCGAAACC.

[0029] The probe sequence is:

[0030] cactctggcgacgcgtttgtggttgaaccgcca(BHQ1-dt)c(THF)g(FAM-dT)ggaggcttcaaaggc(C3spacer).

Embodiment 2

[0031] Example 2 Specificity evaluation of RPA detection

[0032] First follow the steps below to extract the CyHV-II virus, including:

[0033] (1) Add an appropriate amount of PBS buffer and mix well, centrifuge at 8000rpm for 5min, and discard the supernatant;

[0034] (2) Add 1ml of buffer and 20μL of protease and incubate in a water bath at 56°C for 3h;

[0035] (3) Centrifuge at 8000rpm for 5min, take 750μL of the supernatant and put it in a new centrifuge tube, add phenol: chloroform: isoamyl alcohol at a volume ratio of 25:24:1, mix at 50rpm for 10min, then centrifuge at 8000rpm for 5min, Take 650 μL of supernatant to a new centrifuge tube, repeat the above operation and ensure that the protein layer is not sucked;

[0036] (4) Take 600 μL of supernatant in a new centrifuge tube, add chloroform:isoamyl alcohol at a volume ratio of 24:1, mix at 50 rpm for 10 min, and then centrifuge at 8000 rpm for 5 min;

[0037] (5) Take 480 μL of supernatant in a new centrifuge tu...

Embodiment 3

[0042] Sensitivity evaluation of embodiment 3RPA detection

[0043] The extraction method of CyHV-II virus is the same as embodiment 2, then get the DNA of CyHV-II and carry out multiple dilution, each dilution is carried out RPA fluorescence quantitative PCR amplification, wherein, 1 and 2 are positive DNA samples, and 2 is the dilution 10 3 times for the positive DNA sample, 3 times for the negative control water. The experimental results are attached figure 2 As shown, the No. 1 positive sample can detect obvious bands in the 5th cycle (about 4min), and the significant experimental results can be observed in the 10th cycle (about 8min); the No. 2 sample can be detected in the 10th cycle (about 8min) obvious bands can be detected, and significant experimental results can be observed in the 15th cycle (about 16min); No. 3 negative sample has no non-specific amplification bands.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses an RPA kit for detecting cyprinid herpesvirus 2, CyHV-II in real time at constant temperature, and a primer and a probe special for the RPA kit. The forward primer sequence ofthe primer special for the RPA is CCCAGGAGACCAGCAGACTGTTGAACCCGTAC, and the reverse primer sequence of the primer is GTATCCGCCTCGTCCATCATAGAGCCGAAACC; the sequence of the probe is cactctggcgacgcgtttgtggttgaaccgcca(BHQ1-dt)c(THF)g(FAM-dT)ggaggcttcaaaggc(C3spacer), a (BHQ1-dt) perssad exists in the 34 bp, a (THF) perssad exists in the 36 bp, an (FAM-dT) perssad exists in the 38 bp, and (C3spacer) is contained in the tail for modification. By means of the RPA kit including the primer and the probe, cyprinid herpesvirus 2, CyHV-II can be quickly and successfully detected.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a detection technology of type II carp herpes virus, in particular to an RPA kit for real-time detection of type II carp herpes virus at a constant temperature and its special primers and probes, and its application in detecting type II carp herpes virus. Background technique [0002] Herpesviral haematopoietic necrosis (HVHN) is a highly pathogenic viral disease of golden (crucian) fish, and its pathogen is type II carp herpesvirus (cyprinid herpesvirus 2, CyHV-II). Frequent outbreaks have had a devastating impact on the crucian carp farming industry. Cyprinivirus is an enveloped, double-stranded linear large DNA genome virus with a hexagonal nucleocapsid and a diameter of 175-200nm [1-5] , CyHV-II infection of crucian carp can cause extensive hemorrhage in its internal organs, gills and body surface, leading to a mortality rate of over 90% in crucian carp. [0003] Among the conven...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/6844C12Q1/705C12Q2521/507C12Q2522/101C12Q2561/113C12Q2545/114C12Q2531/113
Inventor 王浩吕利群孙萌许丹姜有声余琳
Owner SHANGHAI OCEAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More