Mycobacterium tuberculosis h37rv coding gene and its application

A technology of Mycobacterium tuberculosis and h37rv, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as ribosome translocation, gene boundary errors, and termination site errors

Active Publication Date: 2021-04-20
BEIJING PROTEOME RES CENT
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the three types of methods have their own advantages, they also have disadvantages, such as the long period of traditional isolation and culture and the low culturability of bacteria; the current molecular level detection is still poor in specificity, sensitivity and simplicity; Composition characteristic analysis is costly and complicated to operate
However, since MTB belongs to prokaryotes, due to the deficiencies of prokaryotic genome annotation technology itself, there may still be annotation errors in genome annotation (over-annotation, gene boundary errors, and ORF start and end site errors, alternative splicing, ribosome displacement, missing annotations), which has brought troubles to the in-depth and accurate analysis of biological mechanisms
To solve this problem, Proteogenomics has been used to correct the annotated genes of H37Rv, however, the high rate of false positives, conventional techniques are difficult to predict annotation genes, new gene verification, new gene function analysis and its application, etc. are the challenges faced by the field
[0005] In general, the traditional identification strategy of Mycobacterium tuberculosis complex (MTBC) has the defects of long period, cumbersome steps, low specificity and sensitivity, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mycobacterium tuberculosis h37rv coding gene and its application
  • Mycobacterium tuberculosis h37rv coding gene and its application
  • Mycobacterium tuberculosis h37rv coding gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Searching for missing annotated coding genes in the genome of H37Rv strains

[0034]1.1 High-coverage proteome validation of the H37Rv strain genome

[0035] A deep-coverage study of the proteome of H37Rv strain was carried out using high-coverage proteome technology. Based on the Tuberculosis (20160307) database, its genome was validated for annotation coding genes using the pFind 3 engine. In order to discover new protein coding regions, based on proteogenomics technology, we used pAnno software to translate the whole genome (NC_000962.3) file of H37Rv published in NCBI to a six-reading frame database, and used this database to perform new peptides on mass spectrometry data. Segments and identification of new proteins. In order to reduce the false positive rate, we used three filtering methods to separately estimate the class FDR of annotated peptides and new peptides in the process of data filtering, namely S-FDR, T-FDR I and T-FDRII.

[0036] After dat...

Embodiment 2

[0051] Example 2: Establishing a method for identifying the MTBC complex

[0052] (1) Design primers:

[0053] Based on the CDS sequence of the Rv0609B (-|704475-704672|) gene shown in SEQ ID NO.1, PCR primers were designed using Oligo7.0, and the primer sequences were as follows:

[0054] F: 5'-GACCGACGAGAAGTGCGT-3' (SEQ ID NO. 4);

[0055] R: 5'-GGCACGGCTTTCGAGATA-3' (SEQ ID NO. 5)

[0056] The positional relationship between the above primers and the Rv0609B(-|704475-704672|) gene is shown below, wherein the corresponding positions of the primers are subscripted with a single line.

[0057] GT GACCGACGAGAAGTGCGT GAGATGCGGGGGCGACCAGCTCGTCGAAGGGGCCGTCGTCTGGAACGCGCCGCTGCGTTTCAAGCGCGAAGGTGCCGG C CACTTCAATCGCGGCACCCAGGTCAACGCCGTTGCCTGCGAGACTTGTGGGCATATCGACCTC TATCTCGAAAGCCGTGCC CGCGGCTCGACGAAGTGA (SEQ ID NO. 1)

[0058] (2) Extract the total DNA of the tested strains including M.tuberculosis H37Rv, 40 standard strains of Mycobacterium are preserved by the China Medical B...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention relates to a mycobacterium tuberculosis H37Rv coding gene, which can be used as a standard gene for molecular identification of mycobacterium tuberculosis complex, and is used for molecular identification and clinical detection of mycobacterium tuberculosis complex.

Description

technical field [0001] The invention relates to the field of gene detection, in particular to the identification of pathogenic bacteria species. Background technique [0002] Mycobacterium tuberculosis (MTB) is the causative bacterium of human tuberculosis. It can invade all organs of the body, but tuberculosis is the most common. Tuberculosis is an extremely important infectious disease, which seriously threatens human life and health. About 8 million new cases occur each year, and at least 3 million people die from the disease, according to WHO. The clinical strains of MTB are difficult to cultivate, grow slowly, can cross-infect with other mycobacteria, and are indistinguishable from tuberculosis and other respiratory tract infections, which bring great difficulties to rapid clinical diagnosis and treatment. Therefore, the establishment of a rapid, accurate, specific, sensitive and inexpensive detection method for tuberculosis is a necessary prerequisite for effective ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/31C07K14/35C12Q1/689C12Q1/04C12N15/11C12R1/32
CPCC07K14/35C12Q1/689
Inventor 徐平张瑶王富强孙金帅武舒佳常蕾
Owner BEIJING PROTEOME RES CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap