Neutral protease gene built by molecular chaperone DnaK, protein, bacillus subtilis, and preparation and application of neutral protease gene built by molecular chaperone
A technology of Bacillus subtilis and neutral protease, applied in application, genetic engineering, plant gene improvement, etc., can solve problems such as fire hazards, restriction of enzyme secretion and expression, and reduction of enzyme activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0078] 1. The neutral protease gene constructed by molecular chaperone DnaK, its gene sequence is:
[0079]gctgagaatcctcagcttaaagaaaacctgacgaactttgtgccgaagcattctttggtgcaatctgaattgccttcagtcagtgacaaagcaatcaagcaatacttgaaacaaaacggcaaagtcttcaaaggcaacccttctgagagactgaagctaattgaccacacgaccgatgatctcggctacaagcacttccgttatgtgcctgtcgttaacggtgtgcctgtgaaagactcgcaagtcattattcacgtcgataaatccaacaatgtctatgcgattaacggagaattaaacaacgatgcttctgccaaaacggcaaacagcaaaaaattatctgcaaatcaagcgctggatcatgcttttaaagcaatcggcaaatcacctgaagccgtctctaacggcaacgttgcaaacaaaaacaaagccgagctgaaagcagcggccacaaaagacggtaaataccgactcgcctatgatgtaaccatccgctacatcgaaccggaaccagctaactgggaagtaaccgttgatgcggaaacagggaaagtcctgaaaaagcaaaacaaagtggagcatgccgctgcaaccggaacaggtacgactcttaaaggaaaaacggtctcattaaatatttcttctgaaagcggcaaatatgtaatgcgtgatctttctaaacctaccggaacgcaaattattacgtacgatctgcaaaaccgacaatataacctgccgggcacgctcgtatcaagcactacaaaccagttcacaacttcttctcagcgcgctgccgttgatgcgcattacaatctcggcaaagtgtacgattatttctatcagacgtttaaacgcaacagctacgacaataaaggcggcaaaatcgt...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap