Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for establishing Gadd45a knockout rabbit model by adopting knockout technology

A model and technology that can be applied to other methods of inserting foreign genetic materials, recombinant DNA technology, DNA/RNA fragments, etc., can solve the problem of unclear effects on animals, and achieve the effect of reducing risks

Inactive Publication Date: 2018-01-26
JILIN UNIV
View PDF2 Cites 33 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As one of the genes in this family, Gadd45a is currently studied mainly at the cellular level, and its impact on animals is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for establishing Gadd45a knockout rabbit model by adopting knockout technology
  • Method for establishing Gadd45a knockout rabbit model by adopting knockout technology
  • Method for establishing Gadd45a knockout rabbit model by adopting knockout technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0055] The steps of the present invention are: pUC57-sgRNA vector construction

[0056] ① Construction of sgRNA:

[0057] Select two sgRNA sequence targets at the first exon of the Gadd45a gene, and synthesize two pairs of oligonucleotide chains:

[0058] Sgrna1-F TAGGTCGCGGTCCTCGGCGAAACC

[0059] Sgrna1-RAAACGGTTTCGCCGAGGACCGCGA;

[0060] Sgrna2-F TAGGACTCTCCGCAATCCGGGTGC

[0061] Sgrna2-R AAACGCACCCGGATTGCGGAGAGT;

[0062] ②Synthesis of double-stranded DNA:

[0063] Two synthesized oligonucleotide chains are annealed to form double-stranded DNA; reaction conditions: 95°C for 5 minutes and then room temperature for 1 hour; double-stranded DNA reaction system

[0064] ;

[0065] ③pUC-57 vector linearization:

[0066] When the pUC-57 vector is connected with the DNA synthesized in ②, it needs to be linearized with Bbs I first, and recovered and purified;

[0067] Enzyme digestion reaction system table

[0068] ;

[0069] ④ Ligation of pUC-57 vector and double-stra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for establishing a Gadd45a knockout rabbit model by adopting a knockout technology and belongs to the technical field of biotechnology. The invention aims to establish a rabbit model by knocking out GADD45a gene by utilizing a Grispr / cas9 technology and to provide the method for establishing the Gadd45a knockout rabbit model by adopting the knockout technology andfor researching the influence of the gene on animal liver. The method provided by the invention comprises the following steps: establishing sgRNA; synthesizing double-stranded DNA; linearizing p UC-57 carrier; linking p UC-57 carrier with double-stranded DNA; converting; performing monoclonal picking and plasmid DNA extraction; identifying plasmid sequence; expressing plasmid with CAS9; and performing digestion linearization for in vitro transcription. Through related detection, the invention successfully acquires the Gadd45a knockout rabbit model; the model is established for simulating theclinic pathological processes of the liver diseases, such as, fatty liver, liver cirrhosis and liver cancer after giving the corresponding alcohol stimulation, is capable of effectively forecasting the clinic application effects of new vaccine, new drugs and new diagnostic reagents, and meanwhile, and is capable of greatly reducing the risk in researching and developing the new drugs; and a basismodel is supplied for the clinical research.

Description

technical field [0001] The invention belongs to the field of biotechnology. Background technique [0002] The Gadd45 family is an important gene related to DNA damage repair and plays an important role in cell apoptosis. This family consists of three genes, Gadd45a, Gadd45b, and Gadd45g, that regulate various cell fates and functions, including regulation of the cell cycle, apoptosis, DNA repair, and epigenetic modification. As one of the genes in this family, Gadd45a is currently studied mainly at the cellular level, and its impact on animals is still unclear. Literature has shown that the expression of Gadd45a is down-regulated in liver cirrhosis and hepatocellular carcinoma (HCC) tissues. Therefore, we speculate that Gadd45a may have certain effects on liver function. Therefore, a Gadd45a-knockout rabbit model was established, and alcohol was gavaged to observe the degree of liver injury. [0003] An important basis for research on the mechanism of liver disease and t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/90A01K67/027C12N15/113
Inventor 李晶卢熠李占军赖良学
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com