Construction method of anti-apoptosis CHO-K1 cell line capable of improving expression level by combining with valproic acid
A CHO-K1 and construction method technology, applied in the field of biopharmaceuticals, can solve the time-consuming and labor-intensive problems of gene knockout, and achieve the effects of good tolerance to apoptosis, increased expression level, and prolonged synthesis time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] A method for constructing an anti-apoptotic CHO-K1 cell line that can be used in combination with valproic acid to increase the expression level, the method for constructing comprises the following steps:
[0042] (1) Construct the sgRNA sequence of the BAK gene and synthesize the following sequence:
[0043] TTTGGGAAGCCGGTCAAACCACGTGT;
[0044] TAAAACACGTGGTTTGACCGGCTTCC.
[0045] (2) Construct the sgRNA sequence of the BAX gene and synthesize the following sequence:
[0046] T TTGGCTGATGGCAACTTCAACTGGT ;
[0047] TAAAACCAGTTGAAGTTGCCATCAGC.
[0048] (3) Pass the two pairs of sequences obtained in steps (1) and (2) through a high-temperature water bath at 95°C and then slowly cool down to room temperature, and then use T4 ligase at 16°C overnight for the PSK-u6-gRNA carrier digested with BBsI After ligation, single clones were obtained by transforming competent cells, and the new plasmids were PSK-sgRNA-BAK and PSK-sgRNA-BAX respectively.
[0049] (4) After tr...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com