Molecular marker related to sperm activity character of boar and application
A sperm motility and molecular marker technology, which can be used in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Embodiment 1, the screening of PRM2 gene SNPs
[0025] 1.1 Extraction of Landrace boar sperm total DNA by phenol extraction
[0026] Take 1mL of semen, put it in a 2mL centrifuge tube, centrifuge at 5000rpm for 7 minutes, discard the supernatant; add 1000uL normal saline to each centrifuge tube, pipette repeatedly, mix well, centrifuge at 12000rpm for 7 minutes, discard the supernatant; repeat the above washing steps 1-2 times; add 1000uL sperm lysate (800uL double distilled water, 20uL 0.5M EDTA solution, 10uL 1M Tris-Cl solution, 100uL 10% SDS solution, 20uL β-mercaptoethanol, 20uL 5M NaCl solution) and 15-20uL of proteinase K (10mg / mL), fully blown and mixed, digested at 55°C overnight (about 12h); add about 1000uL of phenol with an equal volume of sample to each centrifuge tube, vigorously invert and shake for 10 minutes to fully mix the two phases until Form a milky white yellowish emulsion, centrifuge at 12000rpm at 4°C for 15 minutes, transfer the supernatant to...
Embodiment 2
[0037] Example 2 Establishment of PCR-RFLP detection method for PRM2 gene
[0038] 2.1 Primer sequence
[0039] A primer pair for the PRM2g.287G>A site was designed to detect the polymorphism of the variable site in the population. The sequence of the primer pair is as follows:
[0040] Forward primer PRM2_SNP-F 5'CTCTGGGCAGCAGCGCGAAA 3',
[0041] Reverse primer PRM2_SNP-R 5'CCTTCCGCACCCTGGTCTGGA 3'.
[0042] 2.2 PCR amplification conditions
[0043] The total volume of the PCR reaction is 10 μl, of which about 50ng of Landrace pig genomic DNA contains 5ul of 2x Taq PCR Mix (purchased from Beijing Aidelai Biotechnology Co., Ltd.), 0.2ul of the forward primer described in 2.1 above (final concentration 0.02pmol / ul ), reverse primer 0.2ul (final concentration 0.02pmol / ul), Landrace boar genomic DNA 1ul (final concentration 5ng / ul). PCR amplification program: 94°C for 5min, 30×[94°C for 30s, 71°C (-0.5°C / cycle) for 30s, 72°C for 15s], 10×(94°C for 30s, 61°C for 30s, 72°C for...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com