A kind of human bocavirus type 1 antibody indirect ELISA diagnostic kit
A technology for human Boca virus and diagnostic kit, which is applied to measurement devices, instruments, scientific instruments, etc., can solve problems such as difficult preparation, and achieve the effects of easy purification, short time consumption and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] 1. Cloning of human bocavirus type 1 VP2N gene and construction of prokaryotic expression vector
[0025] Refer to the genome sequence of human Bocavirus type 1 (GU139423.1) in GenBank to design specific primers for the VP2N gene fragment (the gene fragment encoding the N-terminal 210 amino acid truncated protein of human Bocavirus type 1 structural protein VP2). The primer sequences are:
[0026] Upstream primer: C GAGCTC TCTGACACTGACATTCAAGA, the underlined part is the Sac I restriction site,
[0027] Downstream primer: CCC AAGCTT ATTGCCTCCAGCTGCA, the underlined part is the Hind III restriction site.
[0028] The VP2N-specific target gene with a size of 630bp was amplified by PCR, and then ligated with the pET28a(+) expression vector to construct the prokaryotic expression vector pET28a-VP2N. PCR, double enzyme digestion and sequencing identification showed that the VP2N gene prokaryotic was successfully constructed Expression vector, its electrophoresis diagra...
Embodiment 2
[0032] 1. Preparation of ELISA antibody detection plate
[0033] The purified VP2N recombinant protein was diluted to a certain concentration with carbonate buffer solution of pH 9.6 as the coating solution, added to the microtiter plate at 100 μL / well, and coated overnight at 4°C. Wash the plate four times with PBST, add 200 μL of 1×blockingbuffer to each well to block at 37°C for 1 hour, wash the plate four times with PBS, dry at room temperature, put in a desiccant and vacuum pack to obtain an ELISA antibody detection plate, and store at 4°C.
[0034] 2. ELISA method operating procedure
[0035] (1) Dilute the 10× concentrated washing solution 10 times to obtain the washing solution.
[0036] (2) Serum to be tested, VP2N antibody positive control serum and negative control serum were diluted 1:100 times with antibody diluent (1×blocking buffer), added to ELISA antibody detection plate at 100 μL per well, and incubated at 37°C for 40 minutes. Shake dry.
[0037] (3) Add 2...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com