Primer, probe, kit and method for detecting bacillus erysipelatos-suis by fluorescent quantitative PCR (Polymerase Chain Reaction)
A fluorescent quantitative technology for Erysipelas suis, which is applied in the field of animal virology and molecular biology, can solve the problems of inaccurate inoculation location, inaccurate counting, and long detection time, achieving short detection time, fast distinction, high specificity and The effect of sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Embodiment 1 Fluorescence quantitative PCR detects primers, probes and methods for Erysipelas suis
[0028] 1, Primer and probe design
[0029] According to the 16S ribosomal gene sequences of seven porcine erysipelas strains registered by NCBI (accession numbers are: AB055908.1, AB055907.1, AB055905.1, NR_040837.1, KP063151.1, KP063150.1 and KJ660062.1) provided Information, through comparative analysis, designed primers F, R and probe P of quantitative PCR, the nucleotide sequence is as follows:
[0030] Upstream primer F: AGGGAATTTTCGGCAATGG (SEQ ID NO: 1);
[0031] Downstream primer R: CCCGAAGGCCKTCTTCA (SEQ ID NO: 2); its K represents T or G;
[0032] Probe P: AAGACTACCGACAAGCCCCACTCACAAC (SEQ ID NO: 3)
[0033] Among them, the 5' end and 3' end of probe P are labeled with FAM and BHQ1, respectively.
[0034] Fluorescent quantitative PCR amplification is carried out by using the above primers and probes, and the Erysipelas suis can be detected through the amp...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com