Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer, probe, kit and method for detecting subtypes of human gene CYP1A2

A CYP1A2 and genotyping technology, applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/testing, etc., can solve problems that are difficult to meet clinical tests, achieve low cost, simplify the operation process, and save costs Effect

Inactive Publication Date: 2017-01-11
SHENZHEN UNI MEDICA TECH
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The current detection methods for CYP1A2 genotyping are limited to the above-mentioned gene chip method and traditional fluorescent quantitative PCR probe method, and its shortcomings are increasingly difficult to meet the requirements of clinical testing
In the study of detecting CYP1A2 genotyping using a novel SNP detection technology with dual fluorescently labeled probes, no one has reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe, kit and method for detecting subtypes of human gene CYP1A2
  • Primer, probe, kit and method for detecting subtypes of human gene CYP1A2
  • Primer, probe, kit and method for detecting subtypes of human gene CYP1A2

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Embodiment 1 detects the kit of human CYP1A2 genotyping

[0046] Primer and Probe Design

[0047] According to the NCBI human CYP1A2 gene sequence, the inventors designed primers and probe nucleotide sequences capable of detecting gene polymorphisms at the -163 site as follows:

[0048] Upstream primer SEQ ID NO: 1: 5'-AAACTGAGATGATGTGTGGAGG-3';

[0049] Downstream primer SEQ ID NO: 2: 5'-CACGCATCAGTGTTTATCAAA-3';

[0050] Probe SEQ ID NO:3: 5'-GTGGGC CCAGGACGCATGGTAGATGGA -3'.

[0051] Among them, the sequence between the 7th nucleotide and the 3' end of the probe is complementary to the corresponding sequence on the target nucleic acid, the probe is labeled with a dual fluorescent reporter group, its 5' end is labeled with FAM, and its 3' end is labeled with VIC , the 8th position of the probe T marks the quenching group ZEN TM Internal Quencher.

[0052] Preparation of CYP1A2 Fluorescence Quantitative PCR Reaction Solution

[0053] The concentration of th...

Embodiment 2

[0060] Fluorescent quantitative PCR detection and analysis of embodiment 2 CYP1A2 genotyping

[0061] (1) Extraction of genomic DNA from human blood samples

[0062] In this example, the blood genome extraction and purification kit produced by Bao'an Branch of Shenzhen Huayinkang Gene Technology Co., Ltd. was used to extract sample DNA. The specific operations are as follows:

[0063] (1) Take out several 1.5ml centrifuge tubes from the extraction kit, and add 200 μl of anticoagulated blood to each tube.

[0064] (2) Add 500 μl buffer CLG solution to the anticoagulant blood, close the cap of the centrifuge tube tightly, vortex for more than 20 seconds, and fully invert and mix. It must be fully mixed or vortexed to ensure the release of genomic DNA.

[0065] (3) Add 100 μl buffer PP solution, vortex or invert back and forth for 10 seconds.

[0066] (4) Centrifuge at 12,000 g for 5 min.

[0067] (5) Take out the DNA purification column from the extraction kit, transfer the s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of genotyping and particularly relates to a primer, probe, kit and method for detecting subtypes of a human gene CYP1A2. The primer and the probe comprise the following nucleotide sequences: the nucleotide sequence of a forward primer is SEQ ID NO: 1: 5'-AAACTGAGATGATGTGTGGAGG-3'; the nucleotide sequence of a reverse primer is SEQ ID NO: 2: 5'-CACGCATCAGTGTTTATCAAA-3'; the nucleotide sequence of the probe is SEQ ID NO: 3: 5'-GTGGGCCCAGGACGCATGGTAGATGGA-3'. The kit comprises the primer, the probe, dNTPs, MgCl2, a mixed enzyme and positive and negative reference substances, wherein the mixed enzyme is prepared from a UNG enzyme and DNA polymerase with the activity of flap endonuclease. According to the method for detecting the subtypes of the gene CYP1A2 by using the kit, different subtypes of a target nucleic acid SNP locus can be detected by one fluorescent probe, so that the operating process is simplified, the cost is reduced, and the detection result is high in resolution and is rapid and accurate.

Description

technical field [0001] The invention belongs to the technical field of genotyping, and in particular relates to a primer, a probe, a kit and a method for detecting human CYP1A2 genotyping. Background technique [0002] In the cytochrome P450 superfamily, the metabolic enzymes related to drug metabolism are mainly CYP1, CYP2, and CYP3 families. CYP1A2 is an important member of the CYP1A subfamily and one of the most important CYP enzymes in the human liver, accounting for 13-15% of the total liver CYP enzymes. CYP1A2 is specifically expressed in liver tissue, and aromatic amines, heterocyclic amines, and some halogenated hydrocarbons are important substrates. There are genetic polymorphisms, and there are individual and racial differences, which lead to differences in the drug metabolism ability of different individuals and races. CYP1A2*1F (-163C>A) is located in intron 1, and the mutation will increase the activity of CYP1A2. Different genotypes of CYP1A2 directly aff...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6858C12Q1/6883C12Q2600/106C12Q2600/156C12Q2563/107C12Q2545/113C12Q2521/301
Inventor 谭爱女罗晓腾郭永超周代志
Owner SHENZHEN UNI MEDICA TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com