Primer, probe, kit and method for detecting subtypes of human gene CYP1A2
A CYP1A2 and genotyping technology, applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/testing, etc., can solve problems that are difficult to meet clinical tests, achieve low cost, simplify the operation process, and save costs Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Embodiment 1 detects the kit of human CYP1A2 genotyping
[0046] Primer and Probe Design
[0047] According to the NCBI human CYP1A2 gene sequence, the inventors designed primers and probe nucleotide sequences capable of detecting gene polymorphisms at the -163 site as follows:
[0048] Upstream primer SEQ ID NO: 1: 5'-AAACTGAGATGATGTGTGGAGG-3';
[0049] Downstream primer SEQ ID NO: 2: 5'-CACGCATCAGTGTTTATCAAA-3';
[0050] Probe SEQ ID NO:3: 5'-GTGGGC CCAGGACGCATGGTAGATGGA -3'.
[0051] Among them, the sequence between the 7th nucleotide and the 3' end of the probe is complementary to the corresponding sequence on the target nucleic acid, the probe is labeled with a dual fluorescent reporter group, its 5' end is labeled with FAM, and its 3' end is labeled with VIC , the 8th position of the probe T marks the quenching group ZEN TM Internal Quencher.
[0052] Preparation of CYP1A2 Fluorescence Quantitative PCR Reaction Solution
[0053] The concentration of th...
Embodiment 2
[0060] Fluorescent quantitative PCR detection and analysis of embodiment 2 CYP1A2 genotyping
[0061] (1) Extraction of genomic DNA from human blood samples
[0062] In this example, the blood genome extraction and purification kit produced by Bao'an Branch of Shenzhen Huayinkang Gene Technology Co., Ltd. was used to extract sample DNA. The specific operations are as follows:
[0063] (1) Take out several 1.5ml centrifuge tubes from the extraction kit, and add 200 μl of anticoagulated blood to each tube.
[0064] (2) Add 500 μl buffer CLG solution to the anticoagulant blood, close the cap of the centrifuge tube tightly, vortex for more than 20 seconds, and fully invert and mix. It must be fully mixed or vortexed to ensure the release of genomic DNA.
[0065] (3) Add 100 μl buffer PP solution, vortex or invert back and forth for 10 seconds.
[0066] (4) Centrifuge at 12,000 g for 5 min.
[0067] (5) Take out the DNA purification column from the extraction kit, transfer the s...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap