Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of indirect ELISA detection kit and detection method for antibody of Pasteurella multocida of bovine origin

A technology for detection kits and Pasteurella, applied in measuring devices, instruments, scientific instruments, etc., to achieve the effects of high biological safety, high homology, and high homology

Active Publication Date: 2018-03-27
SOUTHWEST UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to solve the shortcomings and deficiencies of the prior art, aiming at the technical problem that there is no commercially available detection kit for detecting the antibody level of Pasteurella multocida of bovine origin in China at present, and to provide a method that can effectively evaluate the bovine-derived Pasteurella multocida antibody level. Pasteurella multocida vaccine immunization effect and non-immunized cattle herd Pasteurella multocida infection serum epidemiological investigation of bovine Pasteurella multocida antibody indirect ELISA detection kit and its detection method, the kit has rapid , specific, sensitive, stable and other characteristics

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of indirect ELISA detection kit and detection method for antibody of Pasteurella multocida of bovine origin
  • A kind of indirect ELISA detection kit and detection method for antibody of Pasteurella multocida of bovine origin
  • A kind of indirect ELISA detection kit and detection method for antibody of Pasteurella multocida of bovine origin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Screening of bovine-derived Pasteurella multocida specific antigenic protein:

[0026] Sequence the whole genome sequence of Pasteurella multocida type A, B and F strains of bovine origin, through the whole genome of Pasteurella multocida type A, B and F strains of bovine origin Sequence comparison analysis, according to the score value predicted to have a signal peptide, 32 candidate genes were screened from more than 200 genes shared by types A, B, and F, and the amino acid sequences of these genes translated into proteins were transferred to the NCBI database Conduct comparative analysis (http: / / blast.ncbi.nlm.nih.gov) and antigen epitope analysis (http: / / www.cbs.dtu.dk / services / BepiPred / ), and conduct a comprehensive analysis based on the comparison results The total score, coverage, homology and epitope results screened out the 0230 gene; further bioinformatics and PCR analysis of the 0230 gene and its encoded protein proved that the gene and its encoded ...

Embodiment 2

[0027] Example 2 Cloning and expression of Pasteurella multocida 0230 gene and immunoprotective assay of expressed protein:

[0028] According to the CQ2 genome sequence of the bovine Pasteurella multocida capsular serum type A strain, the amplification primers for the 0230 gene were designed: upstream primer 5'-gagtca gaattc gatgtgattgcagataattt; downstream primer 5'-gagtca ctcgag gaacataagaagatgcccat. The underlined segment in the upstream primer is Eco RI restriction site, the underlined segment in the downstream primer is xho I restriction site.

[0029]Genomic DNA of Pasteurella multocida capsular serotype A strain CQ2 from cattle was extracted and used as a template to amplify the 0230 gene by PCR using the primers designed above. The amplification conditions were 94°C for 3min; 94°C for 30s, 60°C ℃ 30s, 72 ℃ 1min, 35 cycles; 72 ℃ extension 10 min, 4 ℃ storage; Eco RI enzyme and xho 1 Enzyme digestion and recovery, the enzyme recovery product is connected wit...

Embodiment 3

[0033] Example 3 Bovine-derived Pasteurella multocida indirect ELISA kit

[0034] The components of the kit include a solid phase carrier coated with purified bovine Pasteurella multocida specific protein 0230, standard positive control serum, standard negative control serum, HRP-labeled rabbit anti-bovine IgG enzyme-labeled secondary antibody, Chromogenic Solution, Stop Solution, Concentrated Wash Solution, Sample Diluent and Serum Dilution Plate. The nucleotide sequence of the bovine Pasteurella multocida specific protein 0230 is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.

[0035] Wherein, the solid phase carrier is a 96-well polystyrene microtiter plate; the bovine-derived Pasteurella multocida specific protein 0230 is a product purified after recombinant expression in Escherichia coli using the method of the above embodiment; Pasteurella mutabilis-specific protein 0230-coated solid phase carrier refers to the use of purified recombinant ant...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an indirect ELISA (enzyme-linked immuno sorbent assay) detection reagent kit and a detection method for bovine-derived pasteurella multocida antibodies. The indirect ELISA detection reagent kit comprises solid-phase carriers enveloped by bovine-derived pasteurella multocida specific protein 0230, HRP (horse radish peroxidase)-labeled IgG (immunoglobulin G) enzyme-labeled second antibodies, standard positive control serum, standard negative control serum, sample diluent, concentrated washing solution, color developing solution and stop solution. The detection method is implemented by the aid of the indirect ELISA detection reagent kit, and includes enabling to-be-detected serum samples to be in contact with the enveloping bovine-derived pasteurella multocida specific protein 0230 on the solid-phase carriers and carrying out heat-insulation incubation; specifically capturing specific antibodies combined on 0230 protein antigens by the aid of the HRP-labeled IgG enzyme-labeled secondary antibodies; developing colors by the aid of color developing agents so as to measure 0230 protein antibody level of the to-be-detected serum samples. The indirect ELISA detection reagent kit and the detection method have the advantages of good specificity and repeatability, high sensitivity and the like.

Description

technical field [0001] The invention relates to the field of veterinary biological products, in particular to an indirect ELISA detection kit and a detection method for a bovine Pasteurella multocida antibody based on a specific protein. Background technique [0002] Pasteurella multocida (Bovine Pasteurella multocida , Pm) is an important pathogen causing hemorrhagic sepsis or respiratory diseases in cattle. Pasteurella multocida can be divided into five capsular serotypes, A, B, D, E, and F, according to their capsular antigens. Among them, the capsular serotypes that are pathogenic to cattle include A, B, and F. Types E and F; Types A and F mainly cause respiratory diseases in cattle, and types B and E mainly cause bovine hemorrhagic sepsis. Pasteurella multocida, which was prevalent in my country in the past, was mainly caused by capsular serum type B. Since 2008, pasteurella multocida type A has been prevalent in many provinces and cities in my country, causing seriou...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N33/569
CPCG01N33/56916
Inventor 彭远义李能章程蓉李杜赵益萍刘舒萍
Owner SOUTHWEST UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com