Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rice blast resistance gene Pi9 functional specificity molecular marker and application thereof

A resistance gene and molecular marker technology, which is applied in the field of agricultural biology, can solve the problems that it is not suitable for large-scale resistance screening and molecular aggregation breeding, and the resistance breeding work is prone to mis-selection or missed selection, etc., and achieves stability and stability. The effect of good product separation, low equipment and technical requirements, and low cost

Inactive Publication Date: 2016-09-21
NANJING FORESTRY UNIV
View PDF3 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the sites where these markers are located have the risk of exchanging with the target gene during meiosis, and misselection or missed selection are prone to occur in resistance breeding.
Huaxia et al. (2013) developed the Pi9SNP marker. Although this marker avoids the disadvantages of non-functional markers, it is not suitable for large-scale resistance screening and molecular aggregation breeding because it requires multiple steps such as enzyme digestion.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice blast resistance gene Pi9 functional specificity molecular marker and application thereof
  • Rice blast resistance gene Pi9 functional specificity molecular marker and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1: Rice blast resistance gene Pi9 gene-specific molecular marker and primer design and detection thereof

[0032] (1) Analysis of Pi9 insertion / deletion (insertion-deletion, InDel) site:

[0033] The partial genome sequences of the publicly published Pi9 and Pi2 rice donor varieties (Genebank accession numbers: DQ285630 and DQ352453 respectively) and the genome sequences of the corresponding regions of the sequenced variety Nipponbare were downloaded from the public database. For the Pi9 locus Sequence comparison was carried out to screen for the insertion / deletion (InDel) difference site specific to Pi9 that could be distinguished from other rice blast allelic resistance genes at this site. The multiple sequence alignment results of rice blast resistance gene Pi9 with gene-specific InDel and C101A51-Pi9, Nip-Pi9 are as follows:

[0034] IRBL9-W-Pi9:

[0035] GGTTTTATCTGGGGAGAAGGAAAAGGAGAGGGAGGGGGGGGGAGGGTCCACTTCCAGCT;

[0036] CIOIA51-Pi9:

[0037] GGTTT...

Embodiment 2

[0067] Example 2: Application of resistance gene Pi9 gene-specific molecular markers in identifying different rice blast resistance genes in the Pi2 / 9 gene cluster region.

[0068] According to the polymorphic PCR product bands, the target gene Pi9 can be distinguished from the resistance genes on other Pi2 / 9 gene clusters. Such as figure 1 As shown, Pi9 can be distinguished from other resistance genes identified at this site according to the position of the band, and 58bp indicates that it contains the Pi9 gene. It can be seen that the test results are consistent with the design analysis, indicating that the resistance gene Pi9 gene-specific molecular markers can be used in the identification of Pi9 gene and Pi2 / 9 gene family alleles.

Embodiment 3

[0069]Embodiment 3: the detection application of resistance gene Pi9 gene-specific molecular marker in other rice varieties

[0070] Eleven important rice varieties were selected, in order: IRBL9-ff(Pi9), Bobai B, Lucaihao, Nanmangzaojaponica, Liushizao, Erjiunan 1, Heijing 2, Nante, Te Qing 2, Zhenhui 129, Yanhui 559, R524.

[0071] Bo B, breeding unit: Guangxi Bobai County Agricultural Science Research Institute,

[0072] Lucai number, breeding unit: Lucai, Xianyou County, Fujian Province,

[0073] Nanmang Zaojaponica, Shanghai Zaojaponica;

[0074] Sixty early, breeding unit: Yiyang, Huarong, Hunan Province;

[0075] Erjiu South No. 1, breeding unit: Jiaxing Agricultural Science Research Institute, Zhejiang Province;

[0076] Heijing No. 2, breeding unit: Heihe Regional Agricultural Science Research Institute of Heilongjiang Province;

[0077] Nante, breeding unit: Jiangxi Academy of Agricultural Sciences; Jiangxi Agricultural Experimental Field;

[0078] Teqing 2, br...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a rice blast resistance gene Pi9 functional specificity molecular marker and application thereof. The molecular marker is named as Pi9InDel, and the nucleotide sequence is shown in SEQ ID NO.1. The molecular marker Pi9InDel being a nucleotide fragment I in a specificity banding pattern with a rice blast resistance gene Pi9 is amplified from total DNA of a rice blast resistant variety carrying a rice blast resistance gene Pi9 through primer pairs of F1 and R1. The molecular marker is a first Pi9 gene specificity InDel marker developed for an internal sequence of the gene Pi9 and has the following advantages that specificity is high, in practical application, cost is low, throughput is high, and the molecular marker can be widely applied to colonies with different genetic backgrounds. By means of the molecular marker, the utilization efficiency of the gene in marker-assisted selection breeding, gene pyramiding breeding and transgenosis breeding can be improved.

Description

technical field [0001] The invention relates to the field of agricultural biotechnology, in particular to the field of rice blast technology, in particular to a functional specific molecular marker of rice blast resistance gene Pi9 and its application. Background technique [0002] Rice blast, caused by Magnapothe oryzae, is one of the most common and serious diseases in rice production, causing a decline in rice quality and causing serious grain losses every year. From the perspective of environmental protection and sustainable agricultural development, breeding and utilizing disease-resistant varieties is the safest and most effective way to control rice blast. In addition, due to the frequent pathogenic variation of rice blast physiological races, the resistance of single resistant varieties will gradually lose within 3-5 years after planting (Yin Desuo et al., 2011). Therefore, mining and rational use of broad-spectrum resistance genes is an important way to obtain dura...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 杨立明罗玉明唐成方继朝刘永锋
Owner NANJING FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com