Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

CXCL13 (chemokine(C-X-C motif) ligand 13) DNA vaccine and application thereof

A DNA vaccine and vaccine technology, applied in the field of medicine, can solve the problems of human body toxicity and side effects, and achieve the effect of high potency

Inactive Publication Date: 2016-07-27
INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The three traditional methods of treating malignant tumors are surgery, radiotherapy and chemotherapy. Although they have certain curative effects, they are not effective for all tumors and have obvious toxic and side effects on the human body.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CXCL13 (chemokine(C-X-C motif) ligand 13) DNA vaccine and application thereof
  • CXCL13 (chemokine(C-X-C motif) ligand 13) DNA vaccine and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Construction and identification of pcDNA3.1-HBc-mCXCL13

[0024] 1. Construction of pcDNA3.1-HBc-mCXCL13

[0025] In order not to affect the original spatial structure of CXCL13 as much as possible so that it can present the original epitope, HBc and CXCL13 were used figure 1 and 2 The indicated linker was connected, and the In-Fusion cloning technique was used to connect to the vector pcDNA3.1(-).

[0026] Cloning primers are as follows:

[0027] 0-linker:

[0028] HBc-HF:

[0029] TGCTGGATATCTGCAGAATTCACGTCATGGACATCGACCCTTAAAG

[0030] HBc-1: TGTGCTGAGCCTCATTGCTGGATCTTCCAAATTAACAC

[0031] mCXCL13-F: ATGAGGCTCAGCACAGCAAC

[0032] mCXCL13-R: TACTAGGTCTCTAGAGGCAGCTCTTCTCTTACTCAC

[0033] HBc-2: TCTAGAGACCTAGTAGTCAGTT

[0034] HBc-TF: CAGCGGTTTAAACTTAAGCTTCTAACATTGAGGTTCCCGAGAT

[0035] S-linker:

[0036] HBc-HF:

[0037] TGCTGGATATCTGCAGAATTCACGTCATGGACATCGACCCTTAAAG

[0038] HBc-1: ACCGCTACCACCACCTGCTGGATCTTCCAAATTAACAC

[0039] mCXCL13-F: GGTG...

Embodiment 2

[0057] Example 2: Identification of expression of pcDNA3.1-HBc-mCXCL13 in HEK293T

[0058] After the plasmid was transfected into HEK293T cells, the expression of HBc-mCxcl13 was successfully detected by RT-PCR and Western Blot.

Embodiment 3

[0059] Example 3: Antibody titers in serum after CXCL13 vaccination are high

[0060] Orbital venous blood was collected, and serum was separated. Enzyme-linked immunosorbent assay (ELLSA) was used to detect high anti-CXCL13 antibody titers at 1 month, 2 months, 4 months and 8 months after immunization.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a CXCL13 (chemokine(C-X-C motif) ligand 13) DNA vaccine and an application thereof. According to the CXCL13 DNA vaccine, overall-length cDNA of CXCL13 and HBc (Hepatitis B core) are connected, and a vector is pcDNA 3.1(-). A tumor targeted drug prepared from the CXCL13 DNA vaccine generates stronger humoral immunity response by stimulating an active immunity system of an organism and can inhibit p-AKT, p-ERK and EMT signal pathways, thereby inhibiting tumor cell growth as well as invasion and metastasis and realizing the anti-tumor effect.

Description

technical field [0001] The invention belongs to the field of medicine, and in particular relates to a CXCL13 (chemokine (C-X-Cmotif) ligand13) cancer vaccine disclosed with functions of preventing and treating diseases. Background technique [0002] Smoking and air pollution are major environmental health issues that my country and the world are facing. There are 1 billion smokers in the world, of which 350 million are in China; 1.59 million people die of lung cancer every year in the world, and 550,000 people die of lung cancer in my country, 90% of which are caused by smoking; air pollution causes 3.7 million premature deaths every year, Among them, there are 350,000 to 500,000 people in my country. Therefore, the prevention and treatment of lung and heart diseases caused by smoking and air pollution have become a major social demand in my country and the world. [0003] Lung cancer has become the malignant tumor with the highest morbidity and mortality in the world. Acco...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/00A61P35/00
CPCA61K39/0011A61K2039/5258A61K2039/53A61K2039/585
Inventor 周光飚张燕飞王桂珍程昕
Owner INST OF ZOOLOGY CHINESE ACAD OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More