Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

OsZFP gene and application of OsZFP gene protein to rice lateral root growth and development regulation and control

A growth and genetic technology, applied in the field of molecular biology, can solve the problems of yeast toxicity, unsuitability for yeast two-hybrid screening system, etc.

Inactive Publication Date: 2016-06-29
ZHEJIANG FORESTRY UNIVERSITY
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, yeast two-hybrid technology has become an important tool for screening protein interactions, and it has a wide range of applications and great advantages for discovering new proteins and new functions of proteins in gene regulatory networks (Fields, S. and Song, O. Anovel genetic system to detect protein- protein interactions. Nature, 1989, 340:245-247; Chien, C.T., Bartel, P.L., Sternglanz, R. and Fields, S. The two-hybrid system: A method to identify and clone genes for proteins that interact with a protein of interest. PANS, 1991, 88: 9578-9582; S.P.Theyasttwo-hybridsystemforstudyingprotein-proteininteractions.CurrOpininBiotech, 1995, 6:59-64); at the same time, yeast two-hybrid also has certain false positive problems, because some foreign proteins are toxic to yeast, it is not suitable for yeast two-hybrid screening system ; or the exogenous protein has the function of activating transcription, which can activate transcription when expressed in yeast, so that the DNA-binding domain hybrid protein can activate transcription without a specific activation domain. Therefore, it is necessary to perform a yeast toxicity test on the bait protein And self-activation test, and verified by in vitro protein interaction (invitropull-down) and westernbolt

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • OsZFP gene and application of OsZFP gene protein to rice lateral root growth and development regulation and control
  • OsZFP gene and application of OsZFP gene protein to rice lateral root growth and development regulation and control
  • OsZFP gene and application of OsZFP gene protein to rice lateral root growth and development regulation and control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] 1. PCR amplification of OsCYP2 gene

[0047] Design PCR amplification primers BD-OsCYP2-F and BD-OsCYP2-R according to the multiple cloning sites (EcoRI and SalI) of the yeast expression vector pGBKT7 and the OsCYP2 gene sequence (519bp), as follows (the underline is the restriction site):

[0048] BD-OsCYP2-F:CGG GAATTC TCTGTGAAATTCGCAAAACCC (SEQ ID NO. 1)

[0049] BD-OsCYP2-R:ACGC GTC GAC ACACCACCACCACCTCCTCCT (SEQ ID NO. 2)

[0050] The OsCYP2 gene was amplified by PCR using the first-strand cDNA of the rice variety 'Aichi Asahi' as a template, and the reaction procedure was as follows:

[0051]

[0052] PCR amplification products were detected by agarose gel electrophoresis and photographed in BIO-RAD gel imager (such as figure 1 shown). The target fragment and the yeast expression vector pGBKT7 were subjected to double digestion (EcoRI and SalI), the target fragment and the vector backbone were recovered, and T4 DNA ligase was used to ligate overnight at ...

Embodiment 2

[0102] 1. Construction of OsZFP gene interference expression vector

[0103] According to the interference expression vector pCAMBIA1300-RNAi multiple cloning site and the OsZFP gene target site sequence (264bp), the forward insert PCR amplification primers RNAi1-F and RNAi1-R, and the reverse insert PCR amplification primers RNAi3-F and RNAi3-R, the schematic diagram of the construction of the interference expression vector is as follows: Figure 7 As shown, the relevant primer sequences are as follows (the underline is the restriction site):

[0104] RNAi1-F:CGC GGATCC TGTAAAATATGTGGAGAATCAGGTC (SEQ ID NO. 7)

[0105] RNAi1-R:GG ACTAGT CTCCTGAATGATTTTATGAACAGCA (SEQ ID NO. 8)

[0106] RNAi3-F:C GAGCTC TGTAAAATATGTGGAGAATCAGGTC (SEQ ID NO.9)

[0107] RNAi3-R:CGG GGTACC CTCCTGAATGATTTTATGAACAGCA (SEQ ID NO. 10).

[0108] OsZFP gene target sequence PCR amplification reaction procedure is as follows:

[0109]

[0110]

[0111]PCR amplification products were de...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an OsZFP gene and application of OsZFP gene protein to rice lateral root growth and development regulation and control. Through a yeast two-hybrid system (in vivo) and a GST pull down (in vitro) technology, downstream target protein OsZFP achieving the mutual action with an important functional protein OsCYP2 for rice lateral root growth and development regulation and control is screened and verified; and an RNAi technology is used for proving that the gene takes part in the rice lateral root growth and development. The invention aims at exploring a novel rice root system growth and development regulation and control gene, enriching a rice lateral root growth and development gene regulation and control network and a relevant signal transduction path, and providing a novel idea for the rice lateral root development gene function study. Meanwhile, important significance is realized on disclosing the rice root system growth and development mechanism and improving the rice productivity.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to the application of the OsZFP gene and its protein in regulating the growth and development of rice lateral roots. Background technique [0002] 细胞亲环素(cyclophilin,Cyp)蛋白家族普遍存在于植物体中(Marivet,J.,Frendo,PandBurkard,G..EffectsofabioticstressesoncyclophilingeneexpressioninmaizeandbeanandsequenceanalysisofbeancyclophilincDNA.PlantSci,1992,84:171-178;Hayman,G.T.andMiernyk,J.A.Thenucleotideanddeducedaminoacidsequencesofapeptidyl- prolylcis-transisomerasefromArabidopsisthaliana.BiochimicaetBiophysicaActa-GeneStructureandexpression,1994,1219:536-538;Godoy,A.V.,Lazzaro,A.S.,Casalongue,C.A.andSegundo,B.S.ExpressionofaSolanumtuberosumcyclophilingeneisregulatedbyfungalinfectionandabioticstressconditions.PlantSci,2000,152:123-134;Lee,J.R.,Park,S.C., Kim, J.Y., Lee, S.S., Park, Y., Cheong, G.W., Hahm, K.S.andLee, S.Y. MolecularandfunctionalcharacterizationofcyclophilinwithantifungalactivityfromChi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82A01H5/00
CPCC07K14/415C12N15/8201C12N15/8227
Inventor 刘宏波崔鹏周伟军阮松林郑志富李兰郑秀文
Owner ZHEJIANG FORESTRY UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com