Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rice spikelet development regulation protein, encoding genes MS1 thereof and application

A technology for regulating proteins and rice, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve problems such as affecting yield

Inactive Publication Date: 2016-06-22
CHINA NAT RICE RES INST
View PDF3 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

GW2 and GW8 mainly control the grain width by affecting the number of glume horizontal cells; GLW7 and DSG1 mainly control the grain size by affecting the length of glume cells; GS2 and GL7 control the size and number of glume cells at the same time, thus affect its output

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice spikelet development regulation protein, encoding genes MS1 thereof and application
  • Rice spikelet development regulation protein, encoding genes MS1 thereof and application
  • Rice spikelet development regulation protein, encoding genes MS1 thereof and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] 1. Rice material:

[0047] Rice (Oryzasativa L.) mutant ms1 (malformedspikelet1), the original wild-type material is the japonica rice variety "Zhonghua 11". The ms1 mutant comes from the mutation generated by the EMS (EthylMethylSulfonate) mutagenesis of Zhonghua 11 (such as figure 1 shown).

[0048] 2. Analyze and target groups:

[0049] The reciprocal cross experiment between the ms1 mutant and "Zhonghua 11" showed that the mutant was controlled by a single recessive gene. The homozygous ms1 mutant was crossed with the indica rice variety NJ06, F 1 Generation selfing, and from F 2 From the population, 962 individuals with abnormal glume and small grain phenotype were selected as the positioning population. At the heading stage, about 1 gram of young leaves were taken from each plant to extract the total DNA.

[0050] 3. DNA extraction

[0051]Genomic DNA for gene localization was extracted from rice leaves by a rapid extraction method of rice trace DNA. Abou...

Embodiment 2

[0062] Plant Transformation:

[0063] Utilize homologous recombination and PCR technology to introduce the SalI restriction site into the amplification primer, the amplification primer is: M34ORF-1F: ATGGGGCGAGGCAAGGTGGTG (SEQ ID NO: 22), M34ORF-1R: CTAGGCCATCCACTCAGGAGG (SEQ ID NO: 23), the annealing temperature is 60°C. The front and rear primers contain SalI restriction sites. Use this primer to PCR amplify the cDNA of Zhonghua 11, recover and purify a 720bp fragment after electrophoresis, and also use SalI to single-enzyme digest the 35S-GFP(S65T)-NOS(pCA1301) vector, and then recover and purify the product with the correct size of the fragment Connect to the digested vector for Escherichia coli transformation, and select positive single clones for sequencing. Obtain the correct transformation vector pCA1301-35S-MS1ORF (such as Figure 6 shown), the rice ms1 mutant was transformed into Agrobacterium tumefaciens strain LBA4404 by electric shock. We used the calli induce...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses rice spikelet development regulation protein.The amino acid sequence of the protein is as shown in (A) Seq ID No: 2; or the protein is formed as shown in (B) formed in the mode that one or more amino acids are added to and / or substituted for in and / or deleted from the amino acid sequence defined by (A), has a function of regulating rice spikelet development and is derived by the (A).The invention further discloses genes for encoding the protein, such as the gene as shown in SEQ ID No:1 and the gene as shown in SEQ ID No:3.; the invention further discloses a recombinant vector and a transformant which contain the genes, a method for regulating gramineous plant spikelet development through gene transformed cells and application of the protein, the genes, the recombinant vector and the transformant to improvement of the yield and quality of gramineous plants.According to the rice spikelet development regulation protein, the encoding genes MSi thereof and application, a map-based cloning technology is utilized to separate the MS1 genes influencing rice spikelet development, the functions of the genes are identified through a genetically modified complementary experiment, and the genes can be utilized to research the molecular mechanism of rice glumes and seed size so that the yield of gramineous plants can be raised, and quality of gramineous plant can be improved.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. Specifically, it relates to a rice spikelet development regulating protein, its coding gene MS1 (MALFORMEDSPIKELET1) and its application. Background technique [0002] Rice (Oryza sativa L.) is an important food crop in the world and a model plant of monocots. Compared with dicotyledonous model plants, rice inflorescence has a unique structural unit of gramineous plants - spikelets. In-depth research on the reproductive development process of rice will not only help in-depth understanding of the formation mechanism of rice spikelets or florets, but also enrich plants. Knowledge of developmental biology and improvement of rice yield and quality are of great significance. With the continuous reduction of arable land, increasing rice production is an urgent task. Rice grain shape is not only one of the important indicators affecting rice yield, but also an important factor affecting the a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/00
CPCC07K14/415C12N15/8261
Inventor 任德勇余海平钱前郭龙彪曾大力吴立文徐乾坤邱振南李自壮
Owner CHINA NAT RICE RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com