Supercharge Your Innovation With Domain-Expert AI Agents!

CYP450 gene participating in DMNT and TMTT biosynthesis and coding product and application of CYP450 gene

A biosynthesis and gene technology, applied in the field of plant molecular biology, can solve the problems of limiting the application of DMNT and TMTT, limiting the understanding and retention of DMNT and TMTT synthesis pathways, etc.

Inactive Publication Date: 2016-06-08
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies in other species are still in the aspects of compound identification and behavioral research, and no DMNT and TMTT synthesis pathway genes have been reported
Especially in important plants in agricultural production, such as vegetables and crops, the research is more limited, which limits our understanding of DMNT and TMTT synthesis pathways, and also limits the application of DMNT and TMTT in green agricultural production
This greatly limits the application of DMNT and TMTT in crops

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CYP450 gene participating in DMNT and TMTT biosynthesis and coding product and application of CYP450 gene
  • CYP450 gene participating in DMNT and TMTT biosynthesis and coding product and application of CYP450 gene
  • CYP450 gene participating in DMNT and TMTT biosynthesis and coding product and application of CYP450 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1. Extraction of Lima Bean Total RNA and Synthesis of cDNA

[0027] The total RNA of Lima bean was extracted according to the instruction manual in the RNAsimple Total RNA Extraction Kit of Tiangen Biochemical Technology Co., Ltd. Agarose gel electrophoresis detection and concentration determination by NanoDrop. The first strand of cDNA was synthesized using the primerscriptTM1ststrandcDNASynthesisSystem Reverse Transcription Kit from TAKATA Company, and the method was referred to the instruction manual in the kit. At the same time, in order to obtain the full length of the gene, use SMARTer TM RACE cDNA amplification kit, for cDNA synthesis, the method refers to the instruction manual in the kit.

Embodiment 2

[0028] Embodiment 2. Primer design and gene cloning

[0029]According to the CYP82 gene of Arabidopsis thaliana (at3g25180), it is available on the Bean Genome website http: / / phytozome.jgi.doe.gov / pz / portal.html#! info? alias=Org_PvulgarisV1.0 was blasted to obtain part of the conserved sequence of the CYP gene of Lima bean. According to the sequence of the gene, conservative primers were designed, and the homologous gene in Lima bean was cloned by RACE technology. 5RACEprimer1: TCCTGAAATAGGGTATTTAGCATT; 5RACEprimer2: CGGGTACTTTGGTGCCCTTTTTAGG; 3RACEprimer1: GGCATGACATTTGGGCTGCAAGTGC; 3RACEprimer2: GTTAGGAGTGGCTTTGCCTAAAGAA, the primers were synthesized by Beijing BGI Corporation. The full length of the gene was obtained by nested PCR.

[0030] Lima bean seeds, publicly available from the Institute of Plant Protection, Chinese Academy of Agricultural Sciences.

[0031] With the cDNA of Lima bean as a template, the PCR product of 1713bp was obtained by RACE amplification ( ...

Embodiment 3

[0033] Application of embodiment 3.PlCYP82 in the synthesis of TMTT and DMNT

[0034] 1. Vector construction

[0035] Using the T-PlCYP82 sequencing vector as a template, the high-fidelity enzyme TranStartFastPfuDNAPolymerase and primers PlCYP82F1 (5'-GATCGGACTACTAGCAGCTGTAATACGACT-3') / PlCYP82R1 (5'-GGCCCTTAGATGCATGCTCGAGCG-3') were used to obtain a 1713bp target fragment (with Nucleotides of Sequence 1 in the Sequence Listing). The above-mentioned target fragment with the A-terminus was ligated with the vector pEASY-El according to the pEASY-ElExpressionKit manual of Quanshijin Biological Co., Ltd., and the obtained ligation product was transformed into common Escherichia coli and spread on the LB plate containing Amp (50mg / ml) Incubate overnight.

[0036] Single clones were picked and detected by T7F (5'-TAATACGACTCACTATA-3') and the downstream primer PlCYP82R1 of the target gene, and positive clones were obtained. The plasmid extracted from the positive clone was sent fo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a CYP450 gene participating in DMNT and TMTT biosynthesis and a coding product and application of the CYP450 gene, and belongs to the field of plant molecular biology. The protein has amino acid sequences shown as SEQ ID NO.2. Experiments prove that the PlCYP82 protein obtained in the mode that the obtained cDNA nucleotide sequences and PlCYP82 coding protein sequences of lima beans PlCYP82 are expressed in yeast WAT21 cells has the activity of catalyzing (E)-nerolidol and (E,E)-geranyl linalool; PlCYP82 gene-transferred arabidopsis thaliana is obtained through a floral-dip method, and a result shows that PlCYP82 gene-transferred arabidopsis thaliana plants can significantly attract female cotesia plutellae.

Description

technical field [0001] The invention belongs to the field of plant molecular biology, and particularly relates to proteins related to the synthesis of DMNT and TMTT compounds, genes encoding them and applications thereof. Background technique [0002] Among the many chemical compounds in plants, some are volatile substances. Plant volatiles play an important role in the process of plant defense against insect pests. When a plant is harmed by a pest, the plant will sense it and synthesize and release volatile substances to avoid the pest or lure the natural enemies of herbivorous insects to reduce the damage of the pest, thereby improving the insect resistance of the plant. Terpene volatiles include monoterpenes, sesquiterpenes, diterpenes and terpene congeners (E)-4,8-dimethyl-1,3,7-nonatriene ((E)-4 , 8-dimethyl-1,3,7-nonatriene, DMNT) and (E,E)-4,8,12-trimethyl-1,3,7,11-tridecenetetraene ((E,E )-4,8,12-trimethyltrideca-1,3,7,11-tetraene, TMTT) etc. DMNT and TMTT are th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/02C12N15/53C12N15/81C12N1/19C12N15/82A01H5/00
CPCC12N9/0071C12N15/8243
Inventor 王桂荣李峰奇杨婷刘杨
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More