CYP450 gene participating in DMNT and TMTT biosynthesis and coding product and application of CYP450 gene
A biosynthesis and gene technology, applied in the field of plant molecular biology, can solve the problems of limiting the application of DMNT and TMTT, limiting the understanding and retention of DMNT and TMTT synthesis pathways, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1. Extraction of Lima Bean Total RNA and Synthesis of cDNA
[0027] The total RNA of Lima bean was extracted according to the instruction manual in the RNAsimple Total RNA Extraction Kit of Tiangen Biochemical Technology Co., Ltd. Agarose gel electrophoresis detection and concentration determination by NanoDrop. The first strand of cDNA was synthesized using the primerscriptTM1ststrandcDNASynthesisSystem Reverse Transcription Kit from TAKATA Company, and the method was referred to the instruction manual in the kit. At the same time, in order to obtain the full length of the gene, use SMARTer TM RACE cDNA amplification kit, for cDNA synthesis, the method refers to the instruction manual in the kit.
Embodiment 2
[0028] Embodiment 2. Primer design and gene cloning
[0029]According to the CYP82 gene of Arabidopsis thaliana (at3g25180), it is available on the Bean Genome website http: / / phytozome.jgi.doe.gov / pz / portal.html#! info? alias=Org_PvulgarisV1.0 was blasted to obtain part of the conserved sequence of the CYP gene of Lima bean. According to the sequence of the gene, conservative primers were designed, and the homologous gene in Lima bean was cloned by RACE technology. 5RACEprimer1: TCCTGAAATAGGGTATTTAGCATT; 5RACEprimer2: CGGGTACTTTGGTGCCCTTTTTAGG; 3RACEprimer1: GGCATGACATTTGGGCTGCAAGTGC; 3RACEprimer2: GTTAGGAGTGGCTTTGCCTAAAGAA, the primers were synthesized by Beijing BGI Corporation. The full length of the gene was obtained by nested PCR.
[0030] Lima bean seeds, publicly available from the Institute of Plant Protection, Chinese Academy of Agricultural Sciences.
[0031] With the cDNA of Lima bean as a template, the PCR product of 1713bp was obtained by RACE amplification ( ...
Embodiment 3
[0033] Application of embodiment 3.PlCYP82 in the synthesis of TMTT and DMNT
[0034] 1. Vector construction
[0035] Using the T-PlCYP82 sequencing vector as a template, the high-fidelity enzyme TranStartFastPfuDNAPolymerase and primers PlCYP82F1 (5'-GATCGGACTACTAGCAGCTGTAATACGACT-3') / PlCYP82R1 (5'-GGCCCTTAGATGCATGCTCGAGCG-3') were used to obtain a 1713bp target fragment (with Nucleotides of Sequence 1 in the Sequence Listing). The above-mentioned target fragment with the A-terminus was ligated with the vector pEASY-El according to the pEASY-ElExpressionKit manual of Quanshijin Biological Co., Ltd., and the obtained ligation product was transformed into common Escherichia coli and spread on the LB plate containing Amp (50mg / ml) Incubate overnight.
[0036] Single clones were picked and detected by T7F (5'-TAATACGACTCACTATA-3') and the downstream primer PlCYP82R1 of the target gene, and positive clones were obtained. The plasmid extracted from the positive clone was sent fo...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com