Supercharge Your Innovation With Domain-Expert AI Agents!

Target bar code gene of bar codes of plants in18 species in melilotus miller and preparation method thereof

A barcoding technology, which is applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve problems such as difficulty in clearly identifying different species, difficulty in determining barcode sequences, and small genetic differences. Good promotion value, easy operation, and the effect of improving efficiency

Active Publication Date: 2016-05-25
LANZHOU UNIVERSITY
View PDF2 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the classification and identification of plants using DNA barcoding technology has been reported, and relevant norms have been formed. However, the application of this technology to the classification and identification of sweet clover will face some difficulties. The species of sweet clover are cross-pollinated plants. Hybridization between different species, small genetic differences, it is difficult to clearly identify different species with a single barcode gene, and it is difficult to determine the standard barcode sequence, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Target bar code gene of bar codes of plants in18 species in melilotus miller and preparation method thereof
  • Target bar code gene of bar codes of plants in18 species in melilotus miller and preparation method thereof
  • Target bar code gene of bar codes of plants in18 species in melilotus miller and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0087] Example 1: A target barcode gene for identifying plant barcodes of 18 species of Melilotus, the main features of which include:

[0088] Species identification of Melilotus, based on the specific primer pair of ITS gene, forward gene (5′-3′): GGAAGKARAAGTCGTAACAAGG; reverse gene (5′-3′): RGTTTCTTTTCCTCCGCTTA.

Embodiment 2

[0089] Example 2: A target barcode gene for identifying plant barcodes of 18 species of Melilotus, the main features of which include:

[0090] The species identification of Melilotus, based on the specific primer pair of psbA-trnH gene, forward gene (5′-3′): GTTATGCATGAACGTAATGCTC; reverse gene (5′-3′): CGCGCATGGTGGATTCACAAATC.

Embodiment 3

[0091] Example 3: A target barcode gene for identifying plant barcodes of 18 species of Melilotus, the main features of which include:

[0092] Species identification of Melilotus, based on rbcL gene specific primer pair, forward gene (5′-3′); AGACCTWTTTGAAGAAGGTTCWGT; reverse gene (5′-3′): TCGGTYAGAGCRGGCATRTGCCA.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a technology for identifying DNA bar codes of plants in 18 species in melilotus miller and an application method thereof. Five genes of ITS, psbA-trnH, rbcL, matK and trnL are selected and integrated to serve as a target DNA bar code gene for identifying 18 species in melilotus miller. Based on data organization, data editing and analysis methods of ContigExpress, a multi-sequence alignment method of ClustalW, a Neighbor-Joining algorithm based on a minimum evolution principle and a no of difference method, a clustering chart is built, and a basic using method of the technology for identifying the DNA bar codes of plants in 18 species in melilotus miller is formed, and a standard classification bar code gene and a corresponding sequence are determined. By means of the technology, the fast, efficient and high-accuracy method for identifying the DNA bar codes of different species in melilotus miller is built, and the method has great significance in differentiation of various species in melilotus miller and utilization of germplasm resources.

Description

Technical field [0001] The present invention mainly relates to the identification of the DNA barcode genes of 18 Melilotus species and their classification standard sequences. Specifically related to the development and application of bar codes for 18 species of Melilotus. Background technique [0002] Melilotus is a one-year or two-year-old cross-pollinated herbaceous plant of the Leguminosae family. There are 19 species worldwide (Stevenson, 1969). The genus Melilotus differs greatly in flower structure, color, seed, leaf and fruit pod morphology (Klebesadel, 1954; Moussavi, 2001). It is difficult to classify according to its morphological characteristics and living habits, and the varieties in production and circulation The degree of mixing is relatively high, which is not conducive to the classification of germplasm resources and the classification and preservation of the storage. At present, there is no better classification standard for the classification and identificati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895
Inventor 张吉宇吴凡骆凯张代玉王彦荣
Owner LANZHOU UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More