LRR-RLK receptor kinase AtMDIS1 and application thereof in breaking reproductive isolation between species
A species and plant technology, applied to LRR-RLK receptor kinase AtMDIS1 and its application fields, can solve problems such as hindering gene exchange, hybrid sterility, and difficulties in agricultural production, and achieve the effects of increasing fertilization efficiency and improving efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1. AtMDIS1 Transformation of Capsellarubella Positive Plants Screening and Identification of Gene Expression.
[0035] 1. Preparation of AtMDIS1 gene expression vector pLAT52:AtMDIS1-NOST driven by LAT52 promoter based on pBI101.
[0036] First, use the Arabidopsis genomic DNA as a template to amplify the DNA fragment of the AtMDIS1 gene with the nucleotide sequence shown in SEQIDNo.: 1, and the amplification primer is MDIS1-F1: TCCC CCCGGG ATGGGTTGTCGATGGAATCCAATT (SEQ ID No.: 4); MDIS1-R1: TCCC CCCGGG TTATGTAGCTTCAGAGGATAAGATCT (SEQ ID No.: 5) (the XmaI restriction site is underlined, and the 5' end of the restriction site is a protective base). The AtMDIS1 fragment was amplified from pollen with TOYOBOKODPlus enzyme, and the amplified product was digested with XmaI and recovered; the pBI101 vector (available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences) was digested with HindⅢ and dephosphorylated with...
Embodiment 2
[0044] Embodiment 2, test optimum Capsellarubella pollen germination medium Carry out Capsellarubella pollen germination test
[0045] Adjust the prepared pollen germination medium to pH 7.5, add Promega's low-melting point agarose (article number V2111) and boil in a water bath until the agarose is completely dissolved, and then place it in a small petri dish (diameter 3.2cm) after cooling to room temperature. , NEST Company, Cat. No. GBD-35-15), pour 1-2 mL of medium into it, and place it in a refrigerator at 4°C for 1-2 hours until it is completely solidified.
[0046] Spread wild-type Capsellarubella pollen evenly on the prepared medium under a dissecting microscope, put wet toilet paper under the small petri dish, and germinate in a constant temperature greenhouse for 8 hours, then count the ratio of germinated pollen / total pollen , to calculate the germination rate.
[0047] Table 1 explores the pollen germination efficiency statistics of the more optimized Capsellarube...
Embodiment 3
[0052] Example 3. Detection of the efficiency of pollen of AtMDIS1 transgenic plants entering mature unfertilized Arabidopsis ovules.
[0053] Arabidopsis thaliana and Capsellarubella were detasseled one day before flowering (use hybrid tweezers to peel off the petals of the small buds that have just turned white, and remove all the anther filaments).
[0054] The pollen of Capsellarubella was pollinated to the unfertilized stigma, and after 30 minutes, the stigma was cut off and placed flat on the pollen germination medium. After culturing for 8 hours, unfertilized ovules of Arabidopsis thaliana were placed near the pollen tube.
[0055] When cultured at 24° C. for 12-14 hours, the efficiency of transgenic pollen tube orientation to ovules was observed under a Leica DM4000 BLED fluorescent microscope.
[0056] Apply aniline blue staining solution (1% w / v aniline blue, SIGMA product number 415049), 100 mM K 3 (PO 4 ) (Sinopharm Group Chemical Reagent Beijing Co., Ltd., pH 10...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com