Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

qRT-PCR (quantitative real-time polymerase chain reaction) for detecting rbsdv (rice black-streaked dwarf virus) and application thereof

A technology for dwarfing black-streaked and virus in rice is applied in the field of PCR detection, which can solve the problems such as the limitation of basic research on the mechanism at the initial stage of the disease, the inability to accurately quantify the copy number of RBSDV, and achieve the convenience of screening of early diseased plants, good economic value and application prospect. , the effect of reducing inspection costs

Inactive Publication Date: 2016-03-30
INST OF CROP SCI CHINESE ACAD OF AGRI SCI +1
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the above detection methods can only be detected in the late stage of RBSDV-infected plants, and can only semi-quantitatively determine the presence or absence, and cannot accurately quantify the copy number of RBSDV
Artificial inoculation experiments found that the best inoculation time of RBSDV is in the three-leaf stage of maize, but conventional detection methods need at least 25 days of artificial inoculation to detect RBSDV. limit

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • qRT-PCR (quantitative real-time polymerase chain reaction) for detecting rbsdv (rice black-streaked dwarf virus) and application thereof
  • qRT-PCR (quantitative real-time polymerase chain reaction) for detecting rbsdv (rice black-streaked dwarf virus) and application thereof
  • qRT-PCR (quantitative real-time polymerase chain reaction) for detecting rbsdv (rice black-streaked dwarf virus) and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] The selection of embodiment 1 rice black-streaked dwarf virus conserved sequence and the design of specific primer

[0041] Through many years of sequencing and comparison of rice black-streaked dwarf virus gene nucleotide sequences, the sequence of the conserved region S5 segment is determined, and its nucleotide sequence is shown in SEQ ID NO.4. The target sequence is to detect rice black-streaked dwarf virus Genetic markers of contracted viruses.

[0042] The present invention was applied in Beijing (I), Hebei Tangshan (II) and Baoding (III), Shandong Jinan (IV) and Jining (V), Henan Zhengzhou (VI) and Xinyang (IX), Jiangsu Yancheng (VII) in 2012-2013 ) and Nanjing (VIII) collected a total of 21 samples of maize rough dwarf and rice black-streaked dwarf with typical symptoms (12IM-1, 13IM-1, 13IIM-1, 13IIIM-1, 13IIIR-1, 13IVM-1 , 13VM-1, 13VM-2, 13VM-3, 13VR-1, 13VR-2, 13VR-3, 13VIM-1, 13VIM-2, 13VIR-1, 13VIIM-1, 13VIIM-2, 13VIIM-3, 13VIIIM -1, 13VIIIR-1, 13IXM-1),...

Embodiment 2

[0060] The establishment of the real-time fluorescent quantitative RT-PCR detection method of embodiment 2 rice black-streaked dwarf virus

[0061] Using the reverse-transcribed cDNA of rice black-streaked dwarf virus total RNA as a template, S5-11 (sequence: ACGCAAACCTTATTTCCGATTC; position in S5: 1842-1864) and S5-12 (sequence: GCATCTAAGGAGACACAGAACCC; position in S5: 3117-3139 ) primers for RT-PCR amplification, the target band was cut and recovered, connected to the pEASY-BluntCloningKit cloning vector, and then the ligated product was transformed into Escherichia coli competent cells DH5α, screened, PCR identified positive clones, extracted recombinant plasmids, and sequenced Analysis, sequencing results are exactly the same as the target fragment is the recombinant plasmid.

[0062] Use S5-11 and S5-12 (Table 1) as primers to amplify the recombinant plasmid, conventional KOD-Plus-NEO (TOYOBO) PCR system (50μl), amplification conditions: 94°C for 5min, 94°C for 30s, 56°C ...

Embodiment 3

[0085] The specificity evaluation of the real-time fluorescent quantitative RT-PCR detection method of embodiment 3 rice black-streaked dwarf virus

[0086] Take the plants with obvious symptoms of corn dwarf mosaic disease and corn rough dwarf disease in the field, extract leaf RNA, and use the method in Example 2 to detect after reverse transcription. The results show that the corn dwarf mosaic disease plants are all negative, and the corn Rough dwarf disease plants were all positive, such as Figure 4 shown. It shows that the real-time fluorescent quantitative RT-PCR detection method of rice black-streaked dwarf virus established in Example 2 of the present invention has good specificity, and can specifically detect the pathogen RBSDV of corn rough dwarf diseased plants.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides qRT-PCR (quantitative real-time polymerase chain reaction) for detecting the RBSDV (rice black-streaked dwarf virus) and an application thereof, belonging to the technical field of PCR detection. Firstly, a conserved segment is determined by comparing genomic sequences of the RBSDV and a primer pair and probe used for detecting the RBSDV are designed by using the conserved region as a target sequence. The nucleotide sequences of the primer pair and probe are respectively shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3. The invention also provides a method and detection kit for carrying out real-time fluorescence quantitative detection on the RBSDV. The detection method has the advantages of accuracy in detection, high sensitivity, strong specificity, simplicity and quickness, can achieve quantitative detection of early infection of crops with the RBSDV, is low in cost and has good economical value and application prospect.

Description

technical field [0001] The invention relates to the technical field of PCR detection, in particular to a target sequence for detecting rice black-streaked dwarf virus, real-time fluorescent quantitative RT-PCR primers and probes, and the present invention also relates to using the target sequence to detect rice black-streaked dwarf virus Detection methods and kits. Background technique [0002] Maize rough dwarf disease (Maizeroughdwarfdisease, MRDD) is a worldwide maize virus disease, and it is also one of the most serious diseases of maize. The typical symptoms of maize rough shrunken disease are that the leaves become wider and shorter, the angle between the leaves becomes smaller, the leaves are dark green, waxy white protrusions appear on the sheaths and bracts, and there is an obvious rough feeling; the internodes of the whole plant become thicker and shorter, and the plant Short, poorly developed or deformed; underdeveloped root system, unable to tassel or have no po...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/68C12Q1/70
Inventor 李新海周羽翁建峰郝转芳李明顺张德贵雍洪军张世煌
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com