ds RNA inhabiting expression of chloride channel gene of aphid and application thereof
A chloride ion channel and gene expression technology, applied in the field of dsRNA that inhibits the expression of aphid chloride ion channel genes, can solve the problems of lack of anti-aphid genes, environmental pollution, harmfulness to humans and animals, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1 Aphids SaCIC4 Gene dsRNA acquisition
[0037] (1) Extraction of total RNA and synthesis of cDNA
[0038] About 20 tube aphids were taken, and total RNA was extracted according to the instructions of the Trizol kit of Beijing Quanshijin Company, purified with RNACleaningKit, and the first strand of cDNA was synthesized by reverse transcription. The operation steps refer to the instructions of the kit.
[0039] (2) Primer design and gene cloning
[0040] Primers P1-F and P1-R were designed using PrimerPrimer5.0 software and synthesized by Beijing Huada Gene Company. GFP gene ( GFP ) fragment was amplified from the 16318hGFP plasmid preserved in the laboratory of the School of Life Science and Technology, Nanyang Normal University, and primers P2-F and P2-R were designed using PrimerPrimer5.0 software.
[0041] P1-F: 5'- TAATACGACTCACTATAGGG GAAAATGAAAAAATCGAAAG-3' (the underlined sequence is the 1st to 20th positions of SEQ ID No: 2);
[0042] P1-R:...
Embodiment 2
[0059] Example 2 SaCIC4 Application of dsRNA in inhibiting the growth of aphids
[0060] (1) Preparation of artificial feed for aphids and preparation of feeders
[0061] References for preparation of artificial feed and feeder (Li Caixia, Gao Lifeng, Gao Lingling, Li Runzhi. A study on feeding aphids in pure artificial nutrient solution. Journal of Shanxi Agricultural University, 1997, 17(3): 225-228.) , filter the artificial feed with a 0.2μm bacterial filter, dispense it into 2.0mL sterilized centrifuge tubes and store in a -20°C refrigerator to avoid repeated freezing and thawing.
[0062] (2) dsRNA ( SaCIC4 dsRNA) in inhibiting the growth of aphids
[0063] Aphid feeding methods refer to the following documents: Jiao Min, Liu Shusheng. The technology of using artificial feed to raise aphids. Entomological Journal of East China, 2004,13(2):102-109.
[0064] Aphid aphid SaCIC4 dsRNA feeding group: put 20 3rd-instar nymphs of A. sativa in each aphid feeder, and add...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap