Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A construction method of attenuated Salmonella typhimurium and its obtained strain and application

A technology of Salmonella typhimurium and its construction method, which is applied in the field of construction of attenuated Salmonella typhimurium, mutant strains of Salmonella typhimurium and its construction, which can solve the problem of decreased resistance of attenuated strains, unsatisfactory attenuation effect, and bacterial resistance Impact and other issues

Inactive Publication Date: 2018-03-16
SICHUAN AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, for Salmonella typhimurium, deletion alone wxya gene or wxya Gene, not only the attenuation effect is not satisfactory, but more importantly, if the synthesis of LPS or ECA is blocked, the resistance of the attenuated strain to the survival pressure from the host body will decrease, which will seriously affect the level of bacterial immune response; and if wxya and wxya After the double deletion of the gene, neither LPS nor ECA can be synthesized, and the resistance of the bacteria to the survival pressure from the host body will be seriously affected

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A construction method of attenuated Salmonella typhimurium and its obtained strain and application
  • A construction method of attenuated Salmonella typhimurium and its obtained strain and application
  • A construction method of attenuated Salmonella typhimurium and its obtained strain and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] 1. Δ rfbB Primer design

[0069] According to the whole genome sequence of Salmonella typhimurium UK-1 published by Genbank (sequence number: CP002614), two pairs of primers were designed to amplify respectively rfbB The upstream and downstream homology arms of the gene have amplified fragment sizes of 410 bp and 497 bp, respectively. The above primers were synthesized by Beijing Huada Gene Co., Ltd. The primer sequences are as follows:

[0070] D rfbB -1F: 5' CATAGAGCAGCTTTTTGCATG3'

[0071] D rfbB -1R: 5' GTCCTTCATATTTTCTATTCCATAAGGCGTA3'

[0072] D rfbB -2F: 5'GAATAGAAAATATGAAGGACGCCAGTAATG3'

[0073] D rfbB -2R: 5' GCGAAATTATTGCCCTTACC3'

[0074] 2, rfbB Amplification and fusion of upstream and downstream homology arms of genes

[0075] A single colony of Salmonella typhimurium S100 was picked and cultured in 5 mL of LB liquid medium overnight (37 °C, 180 rpm), and the bacterial genome extraction kit from Tiangen Biochemical Technology Co., Ltd. was used t...

Embodiment 2

[0087] 1. Δ rffG Primer design

[0088] According to the whole genome sequence of Salmonella typhimurium S100 published by Genbank (sequence number: CP002614), two pairs of primers were designed to amplify respectively rffG The upstream and downstream homology arms of the gene have amplified fragment sizes of 398bp and 376bp respectively. The above primers were synthesized by Beijing Huada Gene Co., Ltd. The primer sequences are as follows:

[0089] D rffG -1F: 5' CGACGGCAAACCGCACTGGG3'

[0090] D rffG -1R: 5' CTGCCGTTTATCAGCGCCAGACTCCTTTGG3'

[0091] D rffG -2F: 5' CTGGCGCTGATAAACGGCAGGTTCTTACTC3'

[0092] D rffG -2R: 5' GCGTTGCCACGCCTGCAGTG3'

[0093] 2, rffG Amplification and fusion of upstream and downstream homology arms of genes

[0094] A single colony of Salmonella typhimurium S100 was picked and cultured in 5 mL of LB liquid medium overnight (37 °C, 180 rpm), and the bacterial genome extraction kit from Tiangen Biochemical Technology Co., Ltd. was use...

Embodiment 3

[0106] S100Δ rfbB Δ rffG Construction and identification of mutant strains

[0107] will carry the suicide plasmid pYA4278- rffG λ pir Escherichia coli and Salmonella typhimurium S100Δ rfbB Conjugation transfer was performed, positive colonies were screened on chloramphenicol-resistant LB plates, positive colonies were cultured and proliferated in LB liquid medium without chloramphenicol resistance, and sucrose-resistant colonies were screened on 10% sucrose plates. Pick a single colony for PCR identification.

[0108] Identification: Take the colony to be tested as a template, use primer D rfbB -1F / D rfbB -2R and D rffG -1F / D rffG -2R was subjected to PCR amplification. strain deletion rfbB After, primer D rfbB -1F / D rfbB The size of the -2R amplification product is the fusion homology arm rfbB -UD size (897 bp), if the deletion is not successful, the PCR product band size is 1974 bp; strain deletion rffG After the gene, primer D rffG -1F / D rffG The -2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides an attenuated strain of Salmonella typhimurium S496, characterized in that the attenuated Salmonella typhimurium S496 is deleted from its own rfbB gene and rffG gene; the pagL gene is replaced by a change containing the arabinose regulatory sequence The rfbB gene with the SD sequence and the start codon changed, the nucleotide sequence of the rfbB gene with the SD sequence and the start codon changed as shown in SEQ ID No.1 containing the arabinose regulatory sequence; the attenuated The classification of the strain is named Salmonella typimurium S496, and it is preserved in the China Center for Type Culture Collection, with the preservation number CCTCC M 2015562, and the preservation time is September 21, 2015. The invention also provides a construction method of the attenuated Salmonella typhimurium. The present invention also provides the application of the above-mentioned bacterial strain or the attenuated bacterial strain constructed by the above-mentioned construction method in vaccines.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to a construction method of attenuated Salmonella typhimurium, the obtained strain and application thereof; in particular, it relates to a Salmonella typhimurium mutant strain that uses arabinose to simultaneously control the synthesis of LPS and ECA and a construction method thereof. Background technique [0002] Lipopolysaccharide (LPS) is an important virulence factor of bacteria, which is directly related to the ability of pathogenic bacteria to infect the body. The Enterobacterial Common Antigen (ECA) is a glycolipid structure shared by members of the Enterobacter family. It also affects the ability of pathogenic bacteria to infect the body. Previous studies have shown that truncating the O antigen on Salmonella LPS and preventing the expression of O antigen in vivo is an important strategy for attenuating Salmonella live vaccines, which can achieve a good attenuatio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N15/74A61K39/112A61P31/04C12R1/42
Inventor 孔庆科黄春赵新新刘青
Owner SICHUAN AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com