Primer and probe for detecting methylation levels of BMP3 and NDRG4 in biological sample
A biological sample, methylation technology, applied in the field of biotechnology and diagnostic research, can solve the problems of long processing cycle, physical trauma and high cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0203] PCR reactions were performed using the following items.
[0204] (1) Sample preparation
[0205] Extract DNA from the collected stool samples in the laboratory, take 20-50ul (2-10μg) DNA, add 1 / 10 volume of 3M NaOH (0.3M final concentration, freshly prepared), and incubate in a metal bath at 37-42°C for 20min; add 5 - 10 times the volume of DNA solution with sulfite conversion solution, mix well, and incubate in a metal bath at 50-55°C in the dark for 16 hours; the modified DNA is purified and recovered using a DNA purification column, and 90% ethanol with 0.2-0.3M NaOH is used in the middle Solution for desulfurization; dissolve in 20-40ul H2O and set aside.
[0206] (2) PCR reaction
[0207] According to the PCR reaction system in Table 1, use the following primers and probes to perform fluorescent quantitative PCR detection on the modified sample DNA.
[0208] Primers and probes:
[0209] Any combination of forward primer, reverse primer and probe of BMP3, select...
Embodiment 3
[0228] A kit for detecting methylation levels of BMP3 and NDRG4 in biological samples
[0229] The kit in this embodiment includes: DNA denaturation solution, sulfite conversion solution, silicon-based membrane column binding solution, DNA desulfurization solution, and PCR reaction solution. Wherein the PCR reaction solution includes PCR buffer, dNTPs, PCR primers, probes and DNA polymerase.
[0230] The forward primers in the PCR of BMP3, NDRG4 and B2M in this example are GTTTAATTTTCGGTTTCGTCGTC (SEQ ID NO: 1) and CGGTTTTCGTTCGTTTTTTTCG (SEQ ID NO: 39), GTAGGTTTGGGTAATTTTAAATAGTGGA (SEQ ID NO: 154), and the reverse primers are CTCCCGACGTCGCTACG ( SEQ ID NO: 58) and TCGTTTATCGGGTATTTTAGTCGCGTAG (SEQ ID NO: 93), TTCTTTCAAAAATATCATCCCCCAAT (SEQ ID NO: 156), the probes are CGCCGAGGCGGTTTTTTGCG (SEQ ID NO: 114) and TTCGTTTATCGGGTATTT (SEQ ID NO: 144), TTCCCTACAAAATCTTCCCCCAAAC ID NO: 158), the combinations of fluorescent substances at the 5' end and 3' end of the probe are respec...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap