Primer set, kit and method for identifying different tobacco varieties
A technology of primer sets and kits, which is applied in the field of identifying primer sets, kits and the like of different tobacco varieties, and can solve problems such as unreported
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0099] Example 1: Identification of DNA fingerprints of 9 tobacco varieties from Guizhou and Yunnan
[0100] The 9 identified tobacco materials are: QY97M, Yunyan 97, K326, Yunyan 87, T24, Pianpianhuang, Concave leaf tobacco, T09-1, Haktian tobacco, among which QY97M was selected from the Yunyan 97 population through systematic selection. The mutant lines produced, T24 and Auyeyan are the mutant strains selected through systematic selection from Yunyan 87 population, and Pianpianhuang are the mutant strains selected through systematic selection from K326. Their genetic relationship is very close. The botanical characters are close to the agronomic characters, and it is difficult to identify them by conventional methods.
[0101] Tobacco genomic DNA extraction: refer to the previous "Tobacco Genomic DNA Extraction Method".
[0102] PCR amplification and result judgment:
[0103] The dosage of each reagent in the multiplex PCR amplification reaction is as follows: Easy Taq DNA...
Embodiment 2
[0120] Example 2: Identification of DNA Fingerprints from 20 Tobacco Varieties in Chongqing
[0121] The 20 tobacco varieties from Chongqing are: Yunyan 97, Yunyan 87, Yunyan 85, Yunyan 99, Yunyan 105, Guiyan No. 1, Guiyan No. 2, Bina No. 1, Jinhai No. 1, Anyan No. 2, Yuyan No. Tobacco 11, Qinyan 201, China Tobacco 104, China Tobacco 203, CF223, K326, Coker206, PVH1452, PVH2254, NC196.
[0122] Tobacco genomic DNA extraction: refer to the previous "Tobacco Genomic DNA Extraction Method".
[0123] 1. Quadruple PCR amplification:
[0124] PCR amplification and result judgment:
[0125] The dosage of each reagent in the multiplex PCR amplification reaction is as follows: Easy Taq DNA polymerase (5U / μL) 0.25μL, dNTPs (10mmol / L) 0.5μL 10×Easy Taq buffer (containing MgCl 2 )2μL, MgCl 2 (20mmol / L) 1μL, forward and reverse primers 0.25μL (50ng / μL), tobacco template DNA (20ng / μL) 2μL, add ddH 2 0 to 25 μL.
[0126] The primers are four pairs of primers with sequences of SEQ ID NO...
Embodiment 3
[0154] Example 3: Genetic relationship analysis and genetic clustering of 7 tobacco varieties from Guizhou
[0155] The tested varieties are: "K326", "Yunyan 87", "T24", "Pianpianhuang", "Ouyeyan", "T09-1" and "Ketianyan".
[0156] Tobacco genomic DNA extraction: refer to the previous "Tobacco Genomic DNA Extraction Method".
[0157] PCR amplification and result judgment:
[0158]The dosage of each reagent in the multiplex PCR amplification reaction is as follows: Easy Taq DNA polymerase (5U / μL) 0.25μL, dNTPs (10mmol / L) 0.5μL 10×Easy Taq buffer (containing MgCl 2 )2μL, MgCl 2 (20mmol / L) 1μL, forward and reverse primers 0.25μL (50ng / μL), tobacco template DNA (20ng / μL) 2μL, add ddH 2 0 to 25 μL.
[0159] The primers are quadruple primers of primer 1+primer 2+primer 3+primer 4. The specific sequence is as follows:
[0160] Primer 1:
[0161] SEQ ID NO:1(5'→3')TGTGGAGCTCCTTTCTTTGC
[0162] SEQ ID NO:2(5'→3')TCAAATCAACAACAAATCCAAT
[0163] Primer 2:
[0164] SEQ ID NO:3(5...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com