Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer set, kit and method for identifying different tobacco varieties

A technology of primer sets and kits, which is applied in the field of identifying primer sets, kits and the like of different tobacco varieties, and can solve problems such as unreported

Inactive Publication Date: 2015-06-24
SOUTHWEST UNIVERSITY
View PDF2 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the development and application of multiple primer PCR technology in tobacco has only been reported in the detection of tobacco virus and tobacco transgene detection, but has not been reported in the identification of tobacco varieties, tobacco kinship and genetic diversity analysis.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer set, kit and method for identifying different tobacco varieties
  • Primer set, kit and method for identifying different tobacco varieties
  • Primer set, kit and method for identifying different tobacco varieties

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0099] Example 1: Identification of DNA fingerprints of 9 tobacco varieties from Guizhou and Yunnan

[0100] The 9 identified tobacco materials are: QY97M, Yunyan 97, K326, Yunyan 87, T24, Pianpianhuang, Concave leaf tobacco, T09-1, Haktian tobacco, among which QY97M was selected from the Yunyan 97 population through systematic selection. The mutant lines produced, T24 and Auyeyan are the mutant strains selected through systematic selection from Yunyan 87 population, and Pianpianhuang are the mutant strains selected through systematic selection from K326. Their genetic relationship is very close. The botanical characters are close to the agronomic characters, and it is difficult to identify them by conventional methods.

[0101] Tobacco genomic DNA extraction: refer to the previous "Tobacco Genomic DNA Extraction Method".

[0102] PCR amplification and result judgment:

[0103] The dosage of each reagent in the multiplex PCR amplification reaction is as follows: Easy Taq DNA...

Embodiment 2

[0120] Example 2: Identification of DNA Fingerprints from 20 Tobacco Varieties in Chongqing

[0121] The 20 tobacco varieties from Chongqing are: Yunyan 97, Yunyan 87, Yunyan 85, Yunyan 99, Yunyan 105, Guiyan No. 1, Guiyan No. 2, Bina No. 1, Jinhai No. 1, Anyan No. 2, Yuyan No. Tobacco 11, Qinyan 201, China Tobacco 104, China Tobacco 203, CF223, K326, Coker206, PVH1452, PVH2254, NC196.

[0122] Tobacco genomic DNA extraction: refer to the previous "Tobacco Genomic DNA Extraction Method".

[0123] 1. Quadruple PCR amplification:

[0124] PCR amplification and result judgment:

[0125] The dosage of each reagent in the multiplex PCR amplification reaction is as follows: Easy Taq DNA polymerase (5U / μL) 0.25μL, dNTPs (10mmol / L) 0.5μL 10×Easy Taq buffer (containing MgCl 2 )2μL, MgCl 2 (20mmol / L) 1μL, forward and reverse primers 0.25μL (50ng / μL), tobacco template DNA (20ng / μL) 2μL, add ddH 2 0 to 25 μL.

[0126] The primers are four pairs of primers with sequences of SEQ ID NO...

Embodiment 3

[0154] Example 3: Genetic relationship analysis and genetic clustering of 7 tobacco varieties from Guizhou

[0155] The tested varieties are: "K326", "Yunyan 87", "T24", "Pianpianhuang", "Ouyeyan", "T09-1" and "Ketianyan".

[0156] Tobacco genomic DNA extraction: refer to the previous "Tobacco Genomic DNA Extraction Method".

[0157] PCR amplification and result judgment:

[0158]The dosage of each reagent in the multiplex PCR amplification reaction is as follows: Easy Taq DNA polymerase (5U / μL) 0.25μL, dNTPs (10mmol / L) 0.5μL 10×Easy Taq buffer (containing MgCl 2 )2μL, MgCl 2 (20mmol / L) 1μL, forward and reverse primers 0.25μL (50ng / μL), tobacco template DNA (20ng / μL) 2μL, add ddH 2 0 to 25 μL.

[0159] The primers are quadruple primers of primer 1+primer 2+primer 3+primer 4. The specific sequence is as follows:

[0160] Primer 1:

[0161] SEQ ID NO:1(5'→3')TGTGGAGCTCCTTTCTTTGC

[0162] SEQ ID NO:2(5'→3')TCAAATCAACAACAAATCCAAT

[0163] Primer 2:

[0164] SEQ ID NO:3(5...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer set, an application of the primer set in identification of tobacco varieties and / or determination of genetic relationships of different tobacco varieties, a kit, an application of the kit in identification of the tobacco varieties and / or determination of the genetic relationships of the different tobacco varieties, a method for identifying the tobacco varieties and a method for determining the genetic relationships of the different tobacco varieties. The primer set comprises a primer 1, a primer 2, a primer 3 and a primer 4. By using the primer set to perform multiple PCR (polymerase chain reaction) and selectively perform single PCR, the different tobacco varieties can be quickly and efficiently identified and / or the genetic relationships and genetic diversities of the different tobacco varieties can be identified.

Description

technical field [0001] The present invention relates to the field of agricultural biotechnology. In particular, the present invention relates to the field of tobacco biotechnology. More particularly, the present invention relates to a set of primers, a kit, a primer set or a kit in identifying tobacco varieties and / or determining different Use in genetic relationship of tobacco varieties, a method of identifying tobacco varieties and a method of determining genetic relationship of different tobacco varieties. Background technique [0002] It is very important to identify tobacco varieties in the process of tobacco leaf production and cigarette ingredients, only in this way can the accuracy of cigarette raw material varieties be guaranteed. However, the currently used methods for identifying tobacco varieties are mainly based on field agronomic traits and the appearance of first-cured tobacco leaves, which are difficult and inaccurate to identify, especially for varieties wit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/16
Inventor 张建奎陈婷婷戴秀梅曲存民尹国英袁洪
Owner SOUTHWEST UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More