Non-invasive defection kit for screening susceptibility genes of endometrial carcinoma
A technology of endometrial cancer and a detection kit, which is applied in the determination/testing of microorganisms, biochemical equipment and methods, etc., and can solve problems such as changes in protein functions, affecting tumor growth, and changes in protein-coded amino acid sequences. The method is simple , reduce the probability of morbidity, and the results are accurate and reliable
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1: Use of Endometrial Cancer Detection Kit
[0037] 1. Extract DNA template
[0038] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.
[0039] 2. PCR amplification reaction
[0040] Use the PCR reaction component in the detection kit, which contains the following primer pairs:
[0041] 1) CYP1A1Msp I forward primer: 5'GGGAGGAAGAAGAGGAGGTAG3'
[0042] CYP1A1Msp I reverse primer: 5'AGGTTCTTGAAAGCAGGGACT3'
[0043] 2) CYP1B1Leu432Val forward primer: 5'TTGTGCCTGTCACTATTCCTCA3'
[0044]CYP1B1Leu432Val reverse primer: 5'AGCCAGGATGGAGATGAAGAG3'
[0045] 3) CYP17MspA1I forward primer: 5'CCCATACGAACCGAATAGA3'
[0046] CYP17MspA1I reverse primer: 5'AGTCAAGGTGAAGATCAGGGTAG3'
[0047] 4) MDM2SNP309 forward primer: 5'CGGGAGTTCAGGGTAAAGGT3'
[0048] MDM2SNP309 reverse primer: 5'AGCAAGTCGGTGCTTACCTG3'
[0049] 5) NQ01C609T forward primer: 5'TGGCACAGTTTCAAGGTTTATG3'
[0050] NQ01C6...
Embodiment 2
[0072] Example 2: Gene non-invasive testing services for screening endometrial cancer risk groups
[0073] 1. Non-invasive sampling
[0074] The physician in the laboratory department of the hospital instructed the subjects to use oral swabs to sample oral mucosal epithelial cells, and the samples were stored at room temperature with cell preservation solution.
[0075] 2. DNA extraction
[0076] DNA was extracted from the collected oral mucosal cells by the phenol-chloroform method.
[0077] 3. Genotype detection
[0078] Using the kit provided by the invention, MspI (rs4646903) on the CYP1A1 gene of the subject's genomic DNA, Leu432Val (rs1056836) on the CYP1B1 gene, MspA1I (rs743572) on the CYP17 gene, SNP309 (rs2279744) on the MDM2 gene, NQ01 gene The five SNPs of C609T (rs1800566) were sequenced separately to determine the genotypes of the five SNPs.
[0079] 4. Bioinformatics analysis and risk assessment of endometrial cancer high-risk population
[0080] Through th...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com