Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Non-invasive defection kit for screening susceptibility genes of endometrial carcinoma

A technology of endometrial cancer and a detection kit, which is applied in the determination/testing of microorganisms, biochemical equipment and methods, etc., and can solve problems such as changes in protein functions, affecting tumor growth, and changes in protein-coded amino acid sequences. The method is simple , reduce the probability of morbidity, and the results are accurate and reliable

Inactive Publication Date: 2015-03-25
TAIYUAN DEPTH DECODING GENE TECH CO LTD
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that the sixth exon C609T of NQ01 can cause changes in the amino acid sequence of the protein code, change the protein function, and affect tumor growth

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Non-invasive defection kit for screening susceptibility genes of endometrial carcinoma
  • Non-invasive defection kit for screening susceptibility genes of endometrial carcinoma
  • Non-invasive defection kit for screening susceptibility genes of endometrial carcinoma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Use of Endometrial Cancer Detection Kit

[0037] 1. Extract DNA template

[0038] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.

[0039] 2. PCR amplification reaction

[0040] Use the PCR reaction component in the detection kit, which contains the following primer pairs:

[0041] 1) CYP1A1Msp I forward primer: 5'GGGAGGAAGAAGAGGAGGTAG3'

[0042] CYP1A1Msp I reverse primer: 5'AGGTTCTTGAAAGCAGGGACT3'

[0043] 2) CYP1B1Leu432Val forward primer: 5'TTGTGCCTGTCACTATTCCTCA3'

[0044]CYP1B1Leu432Val reverse primer: 5'AGCCAGGATGGAGATGAAGAG3'

[0045] 3) CYP17MspA1I forward primer: 5'CCCATACGAACCGAATAGA3'

[0046] CYP17MspA1I reverse primer: 5'AGTCAAGGTGAAGATCAGGGTAG3'

[0047] 4) MDM2SNP309 forward primer: 5'CGGGAGTTCAGGGTAAAGGT3'

[0048] MDM2SNP309 reverse primer: 5'AGCAAGTCGGTGCTTACCTG3'

[0049] 5) NQ01C609T forward primer: 5'TGGCACAGTTTCAAGGTTTATG3'

[0050] NQ01C6...

Embodiment 2

[0072] Example 2: Gene non-invasive testing services for screening endometrial cancer risk groups

[0073] 1. Non-invasive sampling

[0074] The physician in the laboratory department of the hospital instructed the subjects to use oral swabs to sample oral mucosal epithelial cells, and the samples were stored at room temperature with cell preservation solution.

[0075] 2. DNA extraction

[0076] DNA was extracted from the collected oral mucosal cells by the phenol-chloroform method.

[0077] 3. Genotype detection

[0078] Using the kit provided by the invention, MspI (rs4646903) on the CYP1A1 gene of the subject's genomic DNA, Leu432Val (rs1056836) on the CYP1B1 gene, MspA1I (rs743572) on the CYP17 gene, SNP309 (rs2279744) on the MDM2 gene, NQ01 gene The five SNPs of C609T (rs1800566) were sequenced separately to determine the genotypes of the five SNPs.

[0079] 4. Bioinformatics analysis and risk assessment of endometrial cancer high-risk population

[0080] Through th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a non-invasive detection kit for screening susceptibility genes of the endometrial carcinoma, belonging to the field of gene detection kits. The invention provides a detection kit which is painless, non-invasive, clean, less in possibility of causing cross infection, and accurate and reliable in result for detecting pathogenic factors and risk factors of endometrial carcinoma. The detection kit comprises a specific primer and a DNA sequencing primer for detecting the genotypes of mononucleotide polymorphic sites, a PCR (polymerase chain reaction) assembly, a PCR production purifying assembly and a DNA sequencing reaction assembly, wherein the specific primer is used for detecting a mononucleotide polymorphic site Msp on a CYP1A1 gene, a mononucleotide polymorphic site Leu432Va1 on a CYP1B1 gene, a mononucleotide polymorphic site MspA1I on a CYP17 gene, a mononucleotide polymorphic site 309 on an MDM2 gene and a mononucleotide polymorphic site C609T on a NQ01 gene. The non-invasive detection kit is mainly applied to the medical and the biological aspects.

Description

technical field [0001] The invention discloses a non-invasive detection kit for screening endometrial cancer susceptibility genes, belonging to the field of gene detection kits. Background technique [0002] Endometrial cancer is a common malignant tumor of the female reproductive tract. It is the first among the three major malignant tumors of the female reproductive organs in European and American countries. After the 1960s in my country, the incidence rate began to increase and the trend of rejuvenation began. Endometrial cancer accounts for about 7% of women's malignant tumors, and its annual new cases and deaths account for 3.9% and 1.7% of women's malignant tumors respectively. Molecular genetic studies have shown that in endometrial cancer, cell proliferation is dysfunctional due to gradual changes in cell regulatory pathways such as activation of proto-oncogenes, inactivation of tumor suppressor genes, and changes in DNA mismatch repair genes. [0003] Recent studie...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6886C12Q2600/156
Inventor 郭文强李成杨华为李珍张弓宁慧青
Owner TAIYUAN DEPTH DECODING GENE TECH CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More