Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A method for preparing rainbow trout infectious hematopoietic necrosis inactivated vaccine

A technology of hematopoietic organ necrosis and inactivated vaccine is applied in the field of preparation of rainbow trout infectious hematopoietic organ necrosis inactivated vaccine, which can solve the problem that a single cell cannot obtain high titer IHNV antigen and the like

Inactive Publication Date: 2016-04-27
LANZHOU WEITESEN BIOTECH
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The preparation method of the present invention uses RTG-2 cells, CHSE-214 cells and EPC cells to alternately culture rainbow trout infectious hematopoietic necrosis virus (IHNV) at a specific ambient temperature to obtain a large amount of high-titer IHNV antigen and produce inactivated Vaccine; solves the technical problem that high-titer IHNV antigen cannot be obtained with a single cell

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for preparing rainbow trout infectious hematopoietic necrosis inactivated vaccine
  • A method for preparing rainbow trout infectious hematopoietic necrosis inactivated vaccine
  • A method for preparing rainbow trout infectious hematopoietic necrosis inactivated vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0022] Preparation of rainbow trout infectious hematopoietic necrosis antigen and its animal immunity experiment and cohabitation challenge protection experiment

[0023] 1. Isolation and identification of IHNV

[0024] 1) Isolation of IHNV

[0025] The diseased material was collected from the rainbow trout farm where the epidemic broke out in Yongdeng, Gansu Province. After grinding and soaking in the virus, it was inoculated with RTG-2 cells grown three days later. Blind passage was carried out at 14°C, and the passage to the tenth generation took five days In case of typical lesions, the cytotoxic solution was collected and frozen for future use.

[0026] 2. Identification of IHNV

[0027] 2.1) Identification of IHNV

[0028] Primers are designed to amplify the partial fragments of the IHNV nucleoprotein gene by RT-PCR, and the designed amplification primers are:

[0029] Upstream IHNs: 5'tcaagggggggagtcctcga3'

[0030] Downstream IHNa: 5'caccgtactttgctgctac3'

[0031...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing a rainbow trout IHN (Infectious Haematopoietic Necrosis) inactivated vaccine, which comprises the following steps: carrying out grinding, filtering and poison dipping processing on pancreas and livers of juvenile fish which is attacked, but is still alive, inoculating rainbow trout gonad (RTG) cells, carrying out blind passaging at 14 DEG C, keeping for 5 days when carrying out blind passaging on the tenth generation, and collecting cell poisonous fluid; inoculating chinook salmon embryonic (CHSE) cells, carrying out passaging at 14 DEG C, and raising the culture temperature by 1 DEG C when passaging for 5 generations each time until the culture temperature is raised to 20 DEG C; and adopting epithelioma papulosum cyprini (EPC) cells to continuously carry out passaging under the condition of 20 DEG C, passaging to the twelfth generation to obtain high-titer virus solution and carrying out inactivation to obtain the rainbow trout IHN inactivated vaccine. According to the preparation method, RTG-2, CHSE-214 and EPC cells are utilized to alternately culture rainbow trout IHN viruses at a specific environment temperature so as to obtain a high-titer IHNV (Infectious Hematopoietic Necrosis Virus) antigen and produce the inactivated vaccine; and the technical difficult problem that the high-titer IHNV antigen cannot be obtained through single cells is solved.

Description

technical field [0001] The invention belongs to the technical field of biological products and relates to a preparation method of an inactivated vaccine for infectious hematopoietic organ necrosis of rainbow trout. Background technique [0002] Infectious hematopoietic necrosis (INH) is a viral infectious disease of fish caused by Rhabdoviridae Infectious Hematopoietic Necrosis Virus (IHNV), which is widely distributed, high in mortality, and extremely harmful. It was established in 1985 It began to be found in various trout farms in Northeast my country, and it is currently spreading and intensifying. Moreover, in recent years, my country has introduced a large number of salmon eggs from abroad every year, but due to the imperfect quarantine technology, infectious hematopoietic organ necrosis, which is seriously harmful, has strong transmission power, and is difficult to prevent and control, has been introduced into my country and spread. The developing my country's rainbow ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K39/205A61P31/14C12N7/00C12R1/93
Inventor 柳纪省李宝玉杨彬李学瑞兰喜殷相平李志勇张韵方玉萍
Owner LANZHOU WEITESEN BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com