Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Tegillarca granosa galactose lectin Tg-GAL and application thereof

A technology of galectin and galactose, which is applied in the field of functional gene screening, can solve the problems that the research on shellfish lectin has just started, and achieve the effect of broad-spectrum bactericidal activity and strong bactericidal effect

Inactive Publication Date: 2014-10-22
ZHEJIANG WANLI UNIV
View PDF1 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, studies have shown that there are obvious functional differences between different species of lectins, and the research on shellfish lectins has just started

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tegillarca granosa galactose lectin Tg-GAL and application thereof
  • Tegillarca granosa galactose lectin Tg-GAL and application thereof
  • Tegillarca granosa galactose lectin Tg-GAL and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0011] 1. Extraction and inversion of RNA from cockle blood cells

[0012] Take fresh cockles, use a needle to extract the blood in the cockle sinuses, take 1ml of blood and put it into a centrifuge tube, centrifuge at 3500 rpm for one minute, remove the supernatant, keep the blood cells, and extract RNA with Trizol reagent. The relative absorbance of A280 and A260 was detected by ultraviolet spectrophotometer, and the integrity of RNA was checked by electrophoresis. The RNA was reversed with the M-MLV Reverse Transcriptase Kit to obtain the first strand of cDNA.

[0013] 2. Subcloning and verification of ORF-containing cDNA of clam galectin (Tg-GAL)

[0014] Design of primers based on cDNA sequence of mature peptide of Tg-GAL gene

[0015] Tg-GAL-ORF-F5'TTGTTAAAATAGAGACAAGATG3'

[0016] Tg-GAL-ORF-R5'TAAAACAAAAGATTTTCAGAAG3'

[0017] To obtain the gene fragment encoding the mature peptide of the gene. PCR reaction program: denaturation at 94°C for 4 min, 1 cycle; denatur...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
purityaaaaaaaaaa
Login to View More

Abstract

The invention aims at providing galactose lectin Tg-GAL and application thereof. An amino acid sequence of the galactose lectin Tg-GAL is as shown in SEQ ID NO:1. The tegillarca granosa galactose lectin (Tg-GAL) fusion protein expressed in the invention has broad-spectrum bactericidal capability, and especially has a stronger sterilizing effect for aquatic animal pathogenic bacterium vibrio, so that a foundation is laid for developing a novel medicament with microorganism-resistant activity and a novel disease prevention and control treatment preparation for substituting antibiotics on aquaculture industry. Compared with a method for extracting galactose lectin from a natural resource, the preparation method disclosed by the invention ensures that galactose lectin is on a large scale and is free of toxicity, so that low-cost large-scale production is possible, and therefore, a novel way is provided for developing sea-farming cowry feed additives and bacterial disease vaccines.

Description

technical field [0001] The invention belongs to the technical field of functional gene screening, and specifically relates to a galectin Tg-GAL and an application thereof. Background technique [0002] Galectin (galectin) is a family in the lectin superfamily, which is widely distributed in various animals. At present, there are 14 members cloned and named from mammals, and they share a highly conserved sugar recognition domain (CRD) consisting of about 135 amino acids, and have a special affinity for β-galactoside, and are involved in cell adhesion, It plays an important role in many physiological and pathological processes such as apoptosis, inflammatory response, and tumor metastasis. There are still relatively few studies on galectin in invertebrates. It has been initially found that it has a variety of biological activities in the blood of invertebrates, and it can selectively agglutinate various cells. It is an important pattern recognition receptor and an immune defe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/435C12N15/12C12N15/63A23K1/16A61K38/17A61P31/04A23K20/163
CPCC07K14/43504
Inventor 包永波林志华董迎辉
Owner ZHEJIANG WANLI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com